ID: 951255780

View in Genome Browser
Species Human (GRCh38)
Location 3:20447775-20447797
Sequence AACTGCACCCTGCAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951255776_951255780 -1 Left 951255776 3:20447753-20447775 CCTGAGCTCTTGTTCTGCAACCA No data
Right 951255780 3:20447775-20447797 AACTGCACCCTGCAGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951255780 Original CRISPR AACTGCACCCTGCAGTTGGG TGG Intergenic
No off target data available for this crispr