ID: 951260136

View in Genome Browser
Species Human (GRCh38)
Location 3:20497432-20497454
Sequence TTGGGTACACACAAACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951260136_951260142 18 Left 951260136 3:20497432-20497454 CCTTCATGTTTGTGTGTACCCAA No data
Right 951260142 3:20497473-20497495 AAGTGAGAACATGCAGTATTTGG 0: 1203
1: 2998
2: 9898
3: 16648
4: 19653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951260136 Original CRISPR TTGGGTACACACAAACATGA AGG (reversed) Intergenic
No off target data available for this crispr