ID: 951268919

View in Genome Browser
Species Human (GRCh38)
Location 3:20602176-20602198
Sequence CTGAACATTCCCATTGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951268919_951268926 4 Left 951268919 3:20602176-20602198 CCATTGCCAATGGGAATGTTCAG No data
Right 951268926 3:20602203-20602225 AATTGGGGTAGCTGCACTGTGGG No data
951268919_951268925 3 Left 951268919 3:20602176-20602198 CCATTGCCAATGGGAATGTTCAG No data
Right 951268925 3:20602202-20602224 GAATTGGGGTAGCTGCACTGTGG No data
951268919_951268929 29 Left 951268919 3:20602176-20602198 CCATTGCCAATGGGAATGTTCAG No data
Right 951268929 3:20602228-20602250 TAAGCTGAGGCTGTGTGATATGG No data
951268919_951268927 16 Left 951268919 3:20602176-20602198 CCATTGCCAATGGGAATGTTCAG No data
Right 951268927 3:20602215-20602237 TGCACTGTGGGCCTAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951268919 Original CRISPR CTGAACATTCCCATTGGCAA TGG (reversed) Intergenic
No off target data available for this crispr