ID: 951275432

View in Genome Browser
Species Human (GRCh38)
Location 3:20679432-20679454
Sequence GCAAATGCAAAATCTCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951275432_951275440 28 Left 951275432 3:20679432-20679454 CCATGCAGAGATTTTGCATTTGC No data
Right 951275440 3:20679483-20679505 GTGTGAGAGTAACAGGACTCGGG No data
951275432_951275439 27 Left 951275432 3:20679432-20679454 CCATGCAGAGATTTTGCATTTGC No data
Right 951275439 3:20679482-20679504 GGTGTGAGAGTAACAGGACTCGG No data
951275432_951275434 -8 Left 951275432 3:20679432-20679454 CCATGCAGAGATTTTGCATTTGC No data
Right 951275434 3:20679447-20679469 GCATTTGCAATAGGCAGAGCAGG No data
951275432_951275438 21 Left 951275432 3:20679432-20679454 CCATGCAGAGATTTTGCATTTGC No data
Right 951275438 3:20679476-20679498 CACAAGGGTGTGAGAGTAACAGG No data
951275432_951275435 5 Left 951275432 3:20679432-20679454 CCATGCAGAGATTTTGCATTTGC No data
Right 951275435 3:20679460-20679482 GCAGAGCAGGCTCCTGCACAAGG No data
951275432_951275436 6 Left 951275432 3:20679432-20679454 CCATGCAGAGATTTTGCATTTGC No data
Right 951275436 3:20679461-20679483 CAGAGCAGGCTCCTGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951275432 Original CRISPR GCAAATGCAAAATCTCTGCA TGG (reversed) Intergenic
No off target data available for this crispr