ID: 951278957

View in Genome Browser
Species Human (GRCh38)
Location 3:20723716-20723738
Sequence GAGGGTTGCAAAAATACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951278957_951278961 18 Left 951278957 3:20723716-20723738 CCTTCAGTATTTTTGCAACCCTC No data
Right 951278961 3:20723757-20723779 CATGGTAGAAAAGAATGTTTTGG No data
951278957_951278962 19 Left 951278957 3:20723716-20723738 CCTTCAGTATTTTTGCAACCCTC No data
Right 951278962 3:20723758-20723780 ATGGTAGAAAAGAATGTTTTGGG No data
951278957_951278963 28 Left 951278957 3:20723716-20723738 CCTTCAGTATTTTTGCAACCCTC No data
Right 951278963 3:20723767-20723789 AAGAATGTTTTGGGCTATGATGG No data
951278957_951278960 0 Left 951278957 3:20723716-20723738 CCTTCAGTATTTTTGCAACCCTC No data
Right 951278960 3:20723739-20723761 TCTAAGAAAAGAGCAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951278957 Original CRISPR GAGGGTTGCAAAAATACTGA AGG (reversed) Intergenic
No off target data available for this crispr