ID: 951279667

View in Genome Browser
Species Human (GRCh38)
Location 3:20732346-20732368
Sequence AGGGAGAGTGCAGAGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951279667_951279680 28 Left 951279667 3:20732346-20732368 CCCACAATCTCTGCACTCTCCCT No data
Right 951279680 3:20732397-20732419 TGTGACCTCTACTGGGGGGATGG No data
951279667_951279675 21 Left 951279667 3:20732346-20732368 CCCACAATCTCTGCACTCTCCCT No data
Right 951279675 3:20732390-20732412 CATGCCATGTGACCTCTACTGGG No data
951279667_951279674 20 Left 951279667 3:20732346-20732368 CCCACAATCTCTGCACTCTCCCT No data
Right 951279674 3:20732389-20732411 TCATGCCATGTGACCTCTACTGG No data
951279667_951279677 23 Left 951279667 3:20732346-20732368 CCCACAATCTCTGCACTCTCCCT No data
Right 951279677 3:20732392-20732414 TGCCATGTGACCTCTACTGGGGG No data
951279667_951279676 22 Left 951279667 3:20732346-20732368 CCCACAATCTCTGCACTCTCCCT No data
Right 951279676 3:20732391-20732413 ATGCCATGTGACCTCTACTGGGG No data
951279667_951279678 24 Left 951279667 3:20732346-20732368 CCCACAATCTCTGCACTCTCCCT No data
Right 951279678 3:20732393-20732415 GCCATGTGACCTCTACTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951279667 Original CRISPR AGGGAGAGTGCAGAGATTGT GGG (reversed) Intergenic
No off target data available for this crispr