ID: 951279677

View in Genome Browser
Species Human (GRCh38)
Location 3:20732392-20732414
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951279672_951279677 -2 Left 951279672 3:20732371-20732393 CCCAACTACACAGATTCTTCATG No data
Right 951279677 3:20732392-20732414 TGCCATGTGACCTCTACTGGGGG No data
951279673_951279677 -3 Left 951279673 3:20732372-20732394 CCAACTACACAGATTCTTCATGC No data
Right 951279677 3:20732392-20732414 TGCCATGTGACCTCTACTGGGGG No data
951279669_951279677 4 Left 951279669 3:20732365-20732387 CCCTTCCCCAACTACACAGATTC No data
Right 951279677 3:20732392-20732414 TGCCATGTGACCTCTACTGGGGG No data
951279667_951279677 23 Left 951279667 3:20732346-20732368 CCCACAATCTCTGCACTCTCCCT No data
Right 951279677 3:20732392-20732414 TGCCATGTGACCTCTACTGGGGG No data
951279671_951279677 -1 Left 951279671 3:20732370-20732392 CCCCAACTACACAGATTCTTCAT No data
Right 951279677 3:20732392-20732414 TGCCATGTGACCTCTACTGGGGG No data
951279670_951279677 3 Left 951279670 3:20732366-20732388 CCTTCCCCAACTACACAGATTCT No data
Right 951279677 3:20732392-20732414 TGCCATGTGACCTCTACTGGGGG No data
951279668_951279677 22 Left 951279668 3:20732347-20732369 CCACAATCTCTGCACTCTCCCTT No data
Right 951279677 3:20732392-20732414 TGCCATGTGACCTCTACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr