ID: 951283341

View in Genome Browser
Species Human (GRCh38)
Location 3:20779595-20779617
Sequence CCCTGCTTAAAGCAACTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951283341_951283344 2 Left 951283341 3:20779595-20779617 CCAGACAGTTGCTTTAAGCAGGG No data
Right 951283344 3:20779620-20779642 CTGATCTCATTCCTACTCACTGG No data
951283341_951283348 21 Left 951283341 3:20779595-20779617 CCAGACAGTTGCTTTAAGCAGGG No data
Right 951283348 3:20779639-20779661 CTGGGCAAGAACTCGCGAAAGGG No data
951283341_951283347 20 Left 951283341 3:20779595-20779617 CCAGACAGTTGCTTTAAGCAGGG No data
Right 951283347 3:20779638-20779660 ACTGGGCAAGAACTCGCGAAAGG No data
951283341_951283349 22 Left 951283341 3:20779595-20779617 CCAGACAGTTGCTTTAAGCAGGG No data
Right 951283349 3:20779640-20779662 TGGGCAAGAACTCGCGAAAGGGG No data
951283341_951283345 3 Left 951283341 3:20779595-20779617 CCAGACAGTTGCTTTAAGCAGGG No data
Right 951283345 3:20779621-20779643 TGATCTCATTCCTACTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951283341 Original CRISPR CCCTGCTTAAAGCAACTGTC TGG (reversed) Intergenic
No off target data available for this crispr