ID: 951283470

View in Genome Browser
Species Human (GRCh38)
Location 3:20780379-20780401
Sequence CACTTCTGGGCTGCCTACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951283470_951283475 8 Left 951283470 3:20780379-20780401 CCATAGTAGGCAGCCCAGAAGTG No data
Right 951283475 3:20780410-20780432 TGAACTACAGCCGGGACTCAAGG No data
951283470_951283473 -1 Left 951283470 3:20780379-20780401 CCATAGTAGGCAGCCCAGAAGTG No data
Right 951283473 3:20780401-20780423 GTAAAGTTGTGAACTACAGCCGG No data
951283470_951283477 16 Left 951283470 3:20780379-20780401 CCATAGTAGGCAGCCCAGAAGTG No data
Right 951283477 3:20780418-20780440 AGCCGGGACTCAAGGAGGAGAGG No data
951283470_951283476 11 Left 951283470 3:20780379-20780401 CCATAGTAGGCAGCCCAGAAGTG No data
Right 951283476 3:20780413-20780435 ACTACAGCCGGGACTCAAGGAGG No data
951283470_951283474 0 Left 951283470 3:20780379-20780401 CCATAGTAGGCAGCCCAGAAGTG No data
Right 951283474 3:20780402-20780424 TAAAGTTGTGAACTACAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951283470 Original CRISPR CACTTCTGGGCTGCCTACTA TGG (reversed) Intergenic
No off target data available for this crispr