ID: 951283473

View in Genome Browser
Species Human (GRCh38)
Location 3:20780401-20780423
Sequence GTAAAGTTGTGAACTACAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951283470_951283473 -1 Left 951283470 3:20780379-20780401 CCATAGTAGGCAGCCCAGAAGTG No data
Right 951283473 3:20780401-20780423 GTAAAGTTGTGAACTACAGCCGG No data
951283467_951283473 7 Left 951283467 3:20780371-20780393 CCCCAGAGCCATAGTAGGCAGCC No data
Right 951283473 3:20780401-20780423 GTAAAGTTGTGAACTACAGCCGG No data
951283469_951283473 5 Left 951283469 3:20780373-20780395 CCAGAGCCATAGTAGGCAGCCCA No data
Right 951283473 3:20780401-20780423 GTAAAGTTGTGAACTACAGCCGG No data
951283468_951283473 6 Left 951283468 3:20780372-20780394 CCCAGAGCCATAGTAGGCAGCCC No data
Right 951283473 3:20780401-20780423 GTAAAGTTGTGAACTACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951283473 Original CRISPR GTAAAGTTGTGAACTACAGC CGG Intergenic