ID: 951283474

View in Genome Browser
Species Human (GRCh38)
Location 3:20780402-20780424
Sequence TAAAGTTGTGAACTACAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951283469_951283474 6 Left 951283469 3:20780373-20780395 CCAGAGCCATAGTAGGCAGCCCA No data
Right 951283474 3:20780402-20780424 TAAAGTTGTGAACTACAGCCGGG No data
951283470_951283474 0 Left 951283470 3:20780379-20780401 CCATAGTAGGCAGCCCAGAAGTG No data
Right 951283474 3:20780402-20780424 TAAAGTTGTGAACTACAGCCGGG No data
951283468_951283474 7 Left 951283468 3:20780372-20780394 CCCAGAGCCATAGTAGGCAGCCC No data
Right 951283474 3:20780402-20780424 TAAAGTTGTGAACTACAGCCGGG No data
951283467_951283474 8 Left 951283467 3:20780371-20780393 CCCCAGAGCCATAGTAGGCAGCC No data
Right 951283474 3:20780402-20780424 TAAAGTTGTGAACTACAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951283474 Original CRISPR TAAAGTTGTGAACTACAGCC GGG Intergenic