ID: 951283477

View in Genome Browser
Species Human (GRCh38)
Location 3:20780418-20780440
Sequence AGCCGGGACTCAAGGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951283470_951283477 16 Left 951283470 3:20780379-20780401 CCATAGTAGGCAGCCCAGAAGTG No data
Right 951283477 3:20780418-20780440 AGCCGGGACTCAAGGAGGAGAGG No data
951283471_951283477 3 Left 951283471 3:20780392-20780414 CCCAGAAGTGTAAAGTTGTGAAC No data
Right 951283477 3:20780418-20780440 AGCCGGGACTCAAGGAGGAGAGG No data
951283469_951283477 22 Left 951283469 3:20780373-20780395 CCAGAGCCATAGTAGGCAGCCCA No data
Right 951283477 3:20780418-20780440 AGCCGGGACTCAAGGAGGAGAGG No data
951283468_951283477 23 Left 951283468 3:20780372-20780394 CCCAGAGCCATAGTAGGCAGCCC No data
Right 951283477 3:20780418-20780440 AGCCGGGACTCAAGGAGGAGAGG No data
951283472_951283477 2 Left 951283472 3:20780393-20780415 CCAGAAGTGTAAAGTTGTGAACT No data
Right 951283477 3:20780418-20780440 AGCCGGGACTCAAGGAGGAGAGG No data
951283467_951283477 24 Left 951283467 3:20780371-20780393 CCCCAGAGCCATAGTAGGCAGCC No data
Right 951283477 3:20780418-20780440 AGCCGGGACTCAAGGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951283477 Original CRISPR AGCCGGGACTCAAGGAGGAG AGG Intergenic