ID: 951291518

View in Genome Browser
Species Human (GRCh38)
Location 3:20876737-20876759
Sequence GACAGCACTTGGCCTATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951291518_951291523 22 Left 951291518 3:20876737-20876759 CCAATAATAGGCCAAGTGCTGTC No data
Right 951291523 3:20876782-20876804 TGCACAAGACAGCAGGGCCTTGG No data
951291518_951291522 16 Left 951291518 3:20876737-20876759 CCAATAATAGGCCAAGTGCTGTC No data
Right 951291522 3:20876776-20876798 GTTATCTGCACAAGACAGCAGGG No data
951291518_951291521 15 Left 951291518 3:20876737-20876759 CCAATAATAGGCCAAGTGCTGTC No data
Right 951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951291518 Original CRISPR GACAGCACTTGGCCTATTAT TGG (reversed) Intergenic
No off target data available for this crispr