ID: 951291521

View in Genome Browser
Species Human (GRCh38)
Location 3:20876775-20876797
Sequence AGTTATCTGCACAAGACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951291515_951291521 25 Left 951291515 3:20876727-20876749 CCACCAAAGCCCAATAATAGGCC No data
Right 951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG No data
951291518_951291521 15 Left 951291518 3:20876737-20876759 CCAATAATAGGCCAAGTGCTGTC No data
Right 951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG No data
951291520_951291521 4 Left 951291520 3:20876748-20876770 CCAAGTGCTGTCTCACAAAAGGA No data
Right 951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG No data
951291516_951291521 22 Left 951291516 3:20876730-20876752 CCAAAGCCCAATAATAGGCCAAG No data
Right 951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG No data
951291517_951291521 16 Left 951291517 3:20876736-20876758 CCCAATAATAGGCCAAGTGCTGT No data
Right 951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951291521 Original CRISPR AGTTATCTGCACAAGACAGC AGG Intergenic
No off target data available for this crispr