ID: 951292745

View in Genome Browser
Species Human (GRCh38)
Location 3:20893606-20893628
Sequence CTGTCCTAAGACCTAGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951292741_951292745 22 Left 951292741 3:20893561-20893583 CCAAATTATCTAAAATTCATAAA No data
Right 951292745 3:20893606-20893628 CTGTCCTAAGACCTAGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951292745 Original CRISPR CTGTCCTAAGACCTAGAATA AGG Intergenic
No off target data available for this crispr