ID: 951293597

View in Genome Browser
Species Human (GRCh38)
Location 3:20904509-20904531
Sequence GGCTTCATATGCCCCTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951293597_951293601 13 Left 951293597 3:20904509-20904531 CCATAACAGGGGCATATGAAGCC No data
Right 951293601 3:20904545-20904567 TGTAGCTGGGATCAGAGTTTAGG No data
951293597_951293600 0 Left 951293597 3:20904509-20904531 CCATAACAGGGGCATATGAAGCC No data
Right 951293600 3:20904532-20904554 ATGAATCTGAAGATGTAGCTGGG No data
951293597_951293599 -1 Left 951293597 3:20904509-20904531 CCATAACAGGGGCATATGAAGCC No data
Right 951293599 3:20904531-20904553 CATGAATCTGAAGATGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951293597 Original CRISPR GGCTTCATATGCCCCTGTTA TGG (reversed) Intergenic