ID: 951294419

View in Genome Browser
Species Human (GRCh38)
Location 3:20916790-20916812
Sequence GGACAAGATAATGCAAAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951294416_951294419 20 Left 951294416 3:20916747-20916769 CCGGTTTCAAGTATAACATAAAG No data
Right 951294419 3:20916790-20916812 GGACAAGATAATGCAAAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951294419 Original CRISPR GGACAAGATAATGCAAAATG CGG Intergenic
No off target data available for this crispr