ID: 951295958

View in Genome Browser
Species Human (GRCh38)
Location 3:20934824-20934846
Sequence ATGCTGGTATTGAAGAAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951295954_951295958 14 Left 951295954 3:20934787-20934809 CCTGGGGAGTTTATAGTAGCAGA No data
Right 951295958 3:20934824-20934846 ATGCTGGTATTGAAGAAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951295958 Original CRISPR ATGCTGGTATTGAAGAAACG TGG Intergenic
No off target data available for this crispr