ID: 951299937

View in Genome Browser
Species Human (GRCh38)
Location 3:20983878-20983900
Sequence GCTGAGATCATGGGGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951299924_951299937 26 Left 951299924 3:20983829-20983851 CCTCAAATTCCTGGGCTCAAGGG No data
Right 951299937 3:20983878-20983900 GCTGAGATCATGGGGTTGGGGGG No data
951299927_951299937 1 Left 951299927 3:20983854-20983876 CCTCTTGCCTCAGCCTTTTGAGT No data
Right 951299937 3:20983878-20983900 GCTGAGATCATGGGGTTGGGGGG No data
951299926_951299937 17 Left 951299926 3:20983838-20983860 CCTGGGCTCAAGGGATCCTCTTG No data
Right 951299937 3:20983878-20983900 GCTGAGATCATGGGGTTGGGGGG No data
951299928_951299937 -6 Left 951299928 3:20983861-20983883 CCTCAGCCTTTTGAGTAGCTGAG No data
Right 951299937 3:20983878-20983900 GCTGAGATCATGGGGTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951299937 Original CRISPR GCTGAGATCATGGGGTTGGG GGG Intergenic