ID: 951301277

View in Genome Browser
Species Human (GRCh38)
Location 3:21000198-21000220
Sequence CTGCCTGTGCTGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951301273_951301277 19 Left 951301273 3:21000156-21000178 CCTTGAAATATCACATGCTCAGT No data
Right 951301277 3:21000198-21000220 CTGCCTGTGCTGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951301277 Original CRISPR CTGCCTGTGCTGATGGAGCA AGG Intergenic
No off target data available for this crispr