ID: 951303259

View in Genome Browser
Species Human (GRCh38)
Location 3:21024752-21024774
Sequence TCGTGTAAGATGTTAACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951303258_951303259 15 Left 951303258 3:21024714-21024736 CCTCTGGTCAGAATGAAGTTTCT No data
Right 951303259 3:21024752-21024774 TCGTGTAAGATGTTAACAATAGG No data
951303256_951303259 24 Left 951303256 3:21024705-21024727 CCCATCTCTCCTCTGGTCAGAAT No data
Right 951303259 3:21024752-21024774 TCGTGTAAGATGTTAACAATAGG No data
951303257_951303259 23 Left 951303257 3:21024706-21024728 CCATCTCTCCTCTGGTCAGAATG No data
Right 951303259 3:21024752-21024774 TCGTGTAAGATGTTAACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951303259 Original CRISPR TCGTGTAAGATGTTAACAAT AGG Intergenic
No off target data available for this crispr