ID: 951305141

View in Genome Browser
Species Human (GRCh38)
Location 3:21050976-21050998
Sequence GACAAGGACCGACCTGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951305141_951305146 25 Left 951305141 3:21050976-21050998 CCATTTGCAGGTCGGTCCTTGTC No data
Right 951305146 3:21051024-21051046 CCTCATTTAATGTCACCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951305141 Original CRISPR GACAAGGACCGACCTGCAAA TGG (reversed) Intergenic
No off target data available for this crispr