ID: 951314433

View in Genome Browser
Species Human (GRCh38)
Location 3:21171299-21171321
Sequence GTGGGACCCCAAATCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951314433_951314438 -1 Left 951314433 3:21171299-21171321 CCACCAAAGATTTGGGGTCCCAC No data
Right 951314438 3:21171321-21171343 CCAAAGATTTCTTCCCAGCCAGG No data
951314433_951314439 0 Left 951314433 3:21171299-21171321 CCACCAAAGATTTGGGGTCCCAC No data
Right 951314439 3:21171322-21171344 CAAAGATTTCTTCCCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951314433 Original CRISPR GTGGGACCCCAAATCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr