ID: 951317796

View in Genome Browser
Species Human (GRCh38)
Location 3:21207543-21207565
Sequence TCTAATCTTTAGTACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951317796_951317798 9 Left 951317796 3:21207543-21207565 CCTTCCATGTACTAAAGATTAGA No data
Right 951317798 3:21207575-21207597 TTTGAATTATGATCTCCCATTGG No data
951317796_951317799 10 Left 951317796 3:21207543-21207565 CCTTCCATGTACTAAAGATTAGA No data
Right 951317799 3:21207576-21207598 TTGAATTATGATCTCCCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951317796 Original CRISPR TCTAATCTTTAGTACATGGA AGG (reversed) Intergenic
No off target data available for this crispr