ID: 951326078

View in Genome Browser
Species Human (GRCh38)
Location 3:21303135-21303157
Sequence CGGAAAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951326066_951326078 24 Left 951326066 3:21303088-21303110 CCCTGCCGGATCTGGAGGGATGG 0: 14
1: 66
2: 136
3: 139
4: 219
Right 951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG No data
951326068_951326078 23 Left 951326068 3:21303089-21303111 CCTGCCGGATCTGGAGGGATGGA No data
Right 951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG No data
951326069_951326078 19 Left 951326069 3:21303093-21303115 CCGGATCTGGAGGGATGGAAGTC 0: 29
1: 69
2: 102
3: 85
4: 220
Right 951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951326078 Original CRISPR CGGAAAACAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr