ID: 951326842

View in Genome Browser
Species Human (GRCh38)
Location 3:21313185-21313207
Sequence ACCAGGGCCTTGAGGGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951326837_951326842 -5 Left 951326837 3:21313167-21313189 CCAAAACAAGCTCAGGGTACCAG No data
Right 951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG No data
951326835_951326842 1 Left 951326835 3:21313161-21313183 CCACTTCCAAAACAAGCTCAGGG No data
Right 951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951326842 Original CRISPR ACCAGGGCCTTGAGGGTAAA AGG Intergenic
No off target data available for this crispr