ID: 951344477

View in Genome Browser
Species Human (GRCh38)
Location 3:21530365-21530387
Sequence TTGAGCAAAGTCTACATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951344477 Original CRISPR TTGAGCAAAGTCTACATTTT AGG Intronic
903136702 1:21314046-21314068 TTGAGCAATGACTTCATTCTAGG + Intronic
909731580 1:78898197-78898219 ATGATAAAAGTCTCCATTTTGGG + Intronic
909819850 1:80048459-80048481 TTGAGCAATGACTAGATTCTAGG - Intergenic
910003409 1:82364695-82364717 TGAAGGAAAGTCTACAGTTTTGG - Intergenic
910418519 1:87028678-87028700 TTTTGCAAACTCTAAATTTTGGG + Intronic
910477337 1:87621311-87621333 TTGGGCAAAGTTGATATTTTAGG + Intergenic
910541299 1:88361131-88361153 ATGAGAAAAGACTACATATTGGG - Intergenic
911763587 1:101645101-101645123 TTGGACAAAGTCAACATTCTTGG + Intergenic
912148874 1:106831452-106831474 TTGAGCACAGGCTACATTCAGGG + Intergenic
913057227 1:115173950-115173972 CTGACCAAAGCCTATATTTTGGG - Intergenic
916092780 1:161321205-161321227 TTCAGCAATGATTACATTTTGGG + Intronic
918557814 1:185825632-185825654 TTATTCAAAGTTTACATTTTAGG + Intronic
919686882 1:200491996-200492018 ATGAACAAAGTCTACATTTGAGG + Intergenic
920696910 1:208187934-208187956 ATGATCAATGTCTCCATTTTAGG + Intronic
922150307 1:222996700-222996722 TTGAGGAAAGTTCACATCTTTGG + Intronic
922967769 1:229706166-229706188 TAGAGTAAAATCTACTTTTTTGG + Intergenic
923192666 1:231634951-231634973 TTGAGAACAATCTACATTTTTGG - Intronic
923863385 1:237914992-237915014 ATGAGCATTGTGTACATTTTTGG - Intergenic
924770248 1:247073637-247073659 TTCAGCAAAGTCCACACATTTGG - Intronic
1064508119 10:16056107-16056129 TTGTGCAAAGTTTAGATTATGGG + Intergenic
1064698541 10:17992693-17992715 CTGAATAAACTCTACATTTTTGG - Intronic
1065370277 10:24977374-24977396 TTGAGTAAATTATACATTTTAGG + Intergenic
1065407378 10:25384187-25384209 TAGAGTTAAGTCTATATTTTAGG + Intronic
1066537744 10:36410046-36410068 TTTACCAAAGTCTAAATTATTGG - Intergenic
1066644746 10:37595008-37595030 TTTACCAAAGTCTAAATTATTGG - Intergenic
1070120193 10:73568733-73568755 TTTATCAAAGGCTATATTTTGGG - Intronic
1070234708 10:74611333-74611355 TTCAGAAAAGTCTACAATTTAGG - Intronic
1071127802 10:82355144-82355166 GTGAGCAAATTCAACACTTTTGG - Intronic
1071791716 10:88961705-88961727 TAGCACAAAGTCTTCATTTTAGG - Intronic
1073399780 10:103247560-103247582 TTGAGCATATTCTAAATTCTGGG - Exonic
1073508367 10:104023226-104023248 CTGAGAAATGTCTACATTTCAGG - Intronic
1078339318 11:10487674-10487696 TTGAGCACAGCCTACTTTTAAGG + Intronic
1080268786 11:30428339-30428361 GTGAGCAAAGTATTAATTTTGGG + Intronic
1081562834 11:44234801-44234823 TTGAGCAATGTCTAAATTTCAGG - Intronic
1085114602 11:73919701-73919723 TGGAGCAAAGTGTACATTAAGGG + Intronic
1085882697 11:80486506-80486528 TTGAGCAACTGCTATATTTTAGG - Intergenic
1086482143 11:87252934-87252956 TTGAACAAATTTTGCATTTTTGG - Intronic
1086819762 11:91421412-91421434 TAGATCTAAGTCTATATTTTGGG + Intergenic
1088538414 11:110886559-110886581 TTGAGCCAATTCTACACTTGGGG - Intergenic
1089319666 11:117616595-117616617 TTATGCAAAGTATACTTTTTTGG - Intronic
1090130250 11:124134766-124134788 CTGAGCATATTCTATATTTTAGG - Intronic
1090449186 11:126791207-126791229 TTGAGGAAAGAGTACATTTTGGG + Intronic
1090490452 11:127155847-127155869 ATGAGCAAAGTCTGTATTCTTGG - Intergenic
1092387426 12:8046878-8046900 TTGAGCAAATGCTACAGTCTTGG - Intronic
1093472714 12:19522078-19522100 TTGAGATAAGTGGACATTTTGGG + Exonic
1094188685 12:27674023-27674045 TTTATTAAAGTCTCCATTTTTGG - Intronic
1094599182 12:31893510-31893532 ATGAGCAAAGTGTCCATTTGGGG - Intergenic
1096938588 12:55313654-55313676 TAGAGCAAAGACTAGTTTTTTGG - Intergenic
1098138641 12:67429258-67429280 ATGAGGAAAGTCTACCTTTTTGG + Intergenic
1098807678 12:75040407-75040429 TTATGCAAAATATACATTTTAGG + Exonic
1099060173 12:77898139-77898161 TTGAACAAACACTAGATTTTTGG + Intronic
1099171762 12:79373053-79373075 TAAATCAGAGTCTACATTTTTGG - Intronic
1104044734 12:125153777-125153799 TTCTGCAAAGTCTACAGTGTGGG + Intergenic
1104099007 12:125588691-125588713 TTGAGCTAAGGGCACATTTTCGG + Intronic
1104207187 12:126650524-126650546 TTGAGCTAAATTTTCATTTTTGG - Intergenic
1104591007 12:130084686-130084708 TAGAGAAATGTCTACATTTCTGG + Intergenic
1107171728 13:37350376-37350398 TTGAACAAAGTCTATTTTTCTGG + Intergenic
1108133462 13:47329321-47329343 TTGAGGAAAGGCTACACTTTTGG + Intergenic
1111721111 13:91946133-91946155 CTGAGCAAGGAGTACATTTTGGG - Intronic
1112838268 13:103544526-103544548 TTGTTCAAAATGTACATTTTAGG + Intergenic
1112951778 13:105006602-105006624 TTGTAAAAAGTTTACATTTTGGG - Intergenic
1115097623 14:29657067-29657089 ATGAGCAAAGAATACATTGTAGG - Intronic
1116169762 14:41385203-41385225 TTAAGGTAAGTGTACATTTTAGG - Intergenic
1117033337 14:51699148-51699170 CTGAAAACAGTCTACATTTTGGG - Intronic
1118419294 14:65583132-65583154 TTGATCAAAGTACACCTTTTGGG + Intronic
1120032771 14:79661490-79661512 TTGAGGAAAGCCTTCATTTTGGG + Intronic
1120434940 14:84469327-84469349 TTTTGCAAAGTCTGGATTTTTGG - Intergenic
1122958712 14:105084686-105084708 TTTGTCAAAGTATACATTTTGGG + Intergenic
1125626171 15:41111010-41111032 GGCAGCAATGTCTACATTTTTGG + Intronic
1126000240 15:44202637-44202659 TTGAGCAAACTCTCCACTTGAGG - Intergenic
1127383775 15:58451225-58451247 TGGAGGAAAGTCAACATATTTGG + Intronic
1135579844 16:23616061-23616083 TTGAGCAAAGTCTAGAGTCAAGG - Intronic
1137038255 16:35585952-35585974 TTCAGCAAACTCTACAGATTTGG - Intergenic
1137884195 16:52085011-52085033 TTTAGAAAAGTCTCTATTTTGGG - Intergenic
1138177810 16:54917206-54917228 TTGTGGAAAGTCATCATTTTAGG + Intergenic
1139244411 16:65427634-65427656 TTGGGCAGTGCCTACATTTTGGG + Intergenic
1140414365 16:74763098-74763120 TTGATCAAGGCCTACACTTTGGG - Intronic
1140599058 16:76452848-76452870 TTAAGCAAATATTACATTTTTGG - Intronic
1141283635 16:82651222-82651244 TTGAGCACTGTCTACATATCAGG + Intronic
1141435716 16:83998711-83998733 CTGAGCAAATACTACATTCTGGG - Intronic
1144250177 17:13408426-13408448 TTGATCAAACACTACATATTAGG + Intergenic
1144384097 17:14732741-14732763 TTTAGCTATGTCTACCTTTTAGG + Intergenic
1144799438 17:17914957-17914979 TTGAGCAACAGCTATATTTTTGG + Intronic
1145084029 17:19920437-19920459 TAGAGCAAGGCCTACCTTTTGGG - Intronic
1151254195 17:72862995-72863017 TTGAGCAAAGTGCAGATTCTTGG + Intronic
1153478469 18:5522671-5522693 TTGACCAATGTCTACATTTAAGG + Intronic
1154080258 18:11249222-11249244 ATCAGCAAAGTCTTCACTTTTGG + Intergenic
1156746957 18:40403929-40403951 TTGTGCAAAGTTTGCAATTTTGG - Intergenic
1157438724 18:47693211-47693233 TTGAGCAGAGTTTACACTCTGGG - Intergenic
1159413475 18:68112201-68112223 TTCAGCAAGATCTACATTTAAGG - Intergenic
1162468816 19:10859802-10859824 GGGAGCAAAGGCTACATTTTGGG + Intronic
1163948370 19:20561627-20561649 TTCAGCAAACTCTACAGATTTGG - Intronic
1164006626 19:21155791-21155813 TTCAGCAAACTCTACAGATTTGG + Intronic
1164017729 19:21267504-21267526 TTCAGCAAACTCTACAGATTTGG - Intronic
1164043545 19:21513609-21513631 TTAAGCAAACTCTACAGATTTGG + Intronic
1164070017 19:21758972-21758994 TTCAGCAAACTCTGCAGTTTTGG - Intronic
1164101507 19:22058585-22058607 TTCAGCAAACTCTACAGATTTGG + Intronic
1164136139 19:22418042-22418064 TTCAGCAAACTCTACAGATTTGG - Intronic
1164176327 19:22778354-22778376 TTTAGCAAACTCTACAAATTTGG - Intronic
1164241089 19:23389731-23389753 TTTAGCAAACTCTACAGATTTGG - Intronic
925897031 2:8480400-8480422 TTTGGAACAGTCTACATTTTTGG - Intergenic
926809663 2:16745251-16745273 TTGAGCAAGGTCTATCTTCTTGG - Intergenic
926979827 2:18557112-18557134 ATGAGAACAGTCTAAATTTTAGG - Intronic
927017918 2:18986250-18986272 TTGAGGAAAATCAACATTTTGGG + Intergenic
927459960 2:23289959-23289981 TTGTGCAATGACTAGATTTTGGG - Intergenic
928558508 2:32451823-32451845 ATGAGAAAAGTCTACATACTGGG - Intronic
928587704 2:32778076-32778098 TGGAGGAAAGTGTACATTTGAGG + Intronic
929755214 2:44758477-44758499 TTGAGGAAAGCCTGCATTTCAGG - Intronic
930364420 2:50421416-50421438 TTAAGCAAAGAATACATCTTAGG + Intronic
930501371 2:52222644-52222666 TTGAGCAAGGAATACACTTTGGG + Intergenic
930870013 2:56160776-56160798 TTTAGGAAAGTATACTTTTTTGG - Intergenic
930916659 2:56699426-56699448 GTGAGCAAAGTATACCTTGTGGG - Intergenic
931466691 2:62494701-62494723 TTTTTAAAAGTCTACATTTTTGG + Intergenic
936170789 2:110171243-110171265 TTCAGCAAAGTTTAAATTTTGGG + Intronic
939298966 2:140307987-140308009 TTGAGCATAGTATACTATTTTGG - Intronic
939657464 2:144845948-144845970 ATGAGCAATGACTACTTTTTTGG + Intergenic
939755833 2:146109265-146109287 TTGAGCAATGTCTTGCTTTTCGG + Intergenic
939780667 2:146443422-146443444 TATGGCAATGTCTACATTTTTGG + Intergenic
940165985 2:150772325-150772347 TTGAGCACTTTCTACCTTTTAGG - Intergenic
940688911 2:156889859-156889881 TTGAGGATAGTCTACATCCTAGG - Intergenic
941189833 2:162367711-162367733 TTGTGCAAAATCTAAATCTTGGG + Intronic
941653042 2:168113955-168113977 TTGAACAAAGTAAACATTTTTGG - Intronic
942980505 2:182074957-182074979 TTGAGGAAGGTTTACAGTTTTGG + Intronic
943122396 2:183753054-183753076 TTCAGGAAAGTCTACTTATTGGG - Intergenic
943840084 2:192569353-192569375 TTAAGAAAACTCAACATTTTTGG + Intergenic
944219480 2:197288084-197288106 TTGGGCAAACCCTAAATTTTTGG - Intronic
944661189 2:201923313-201923335 TTGAGCAAAGCCAAGATTTTAGG - Intergenic
945453472 2:210020662-210020684 TTGAGCATATTCTAAATTCTGGG - Exonic
945469784 2:210214197-210214219 TTGAGCACTGTCTATATTTTTGG - Intronic
945708844 2:213270506-213270528 TTGAAGAAAGTCTATGTTTTGGG + Intergenic
948193329 2:236076770-236076792 GTGAGCCAGGGCTACATTTTGGG + Intronic
1170125831 20:12963222-12963244 TGGAGAAAAGTGAACATTTTAGG - Intergenic
1173630571 20:44511212-44511234 TTGAGTTAAAGCTACATTTTAGG - Intronic
1174488953 20:50878757-50878779 TTGTGCCAACACTACATTTTGGG - Intronic
1175728092 20:61332998-61333020 CTGGGCAAAGTCTTTATTTTTGG + Intronic
1175884618 20:62282498-62282520 ATGGGAAATGTCTACATTTTTGG - Intronic
1177070199 21:16495463-16495485 TTGAGCATAGACTACATATTAGG + Intergenic
1177515160 21:22139997-22140019 TTGAACAAAGTCTACATTTTCGG + Intergenic
1178775868 21:35549927-35549949 TTGAGCAATGGCTACAATTTTGG - Intronic
1179426118 21:41279996-41280018 TTTGGCACAGTCTACTTTTTAGG + Intronic
1183881613 22:40836800-40836822 TTGCACAAAGTCTAAATCTTGGG + Intronic
951344477 3:21530365-21530387 TTGAGCAAAGTCTACATTTTAGG + Intronic
952055537 3:29440530-29440552 TTGAGCAAAGAAAACATTTACGG - Intronic
952081698 3:29766350-29766372 CAGAGCAATGTCAACATTTTAGG - Intronic
954979856 3:54735359-54735381 TTGAGCACAGGACACATTTTGGG + Intronic
955109578 3:55935020-55935042 TGGAGTAAAGGCTACATCTTTGG - Intronic
955894735 3:63687208-63687230 ATGAGAAAAGTCTAAATTTGAGG + Intergenic
956081973 3:65566968-65566990 ATGATAAAAGTCTACATTTGAGG + Intronic
956081999 3:65567271-65567293 ATGACAAAAGTCTACATTTGAGG + Intronic
956333244 3:68134629-68134651 CTGAGCAAAGTCTAACTTTCTGG - Intronic
957152592 3:76504886-76504908 TTGATGATAGTCTTCATTTTGGG + Intronic
957902796 3:86517931-86517953 TTTAAAAAAATCTACATTTTTGG + Intergenic
958602152 3:96309308-96309330 TTGAGAAAATTATACATTTTTGG + Intergenic
959234678 3:103704584-103704606 TTGGACAATGTCTACATGTTTGG + Intergenic
961111969 3:124292062-124292084 TGGAGAAAACTCCACATTTTGGG + Intronic
962086608 3:132198167-132198189 TTGAACAAAGCCCAGATTTTTGG + Intronic
964371628 3:156005963-156005985 TTTAGCAAAATCTACATTTGAGG - Intergenic
964417819 3:156467433-156467455 TAGAGCACATTTTACATTTTTGG - Intronic
964603916 3:158538254-158538276 TTGAGCATATACTACATGTTAGG + Intronic
964746460 3:160017176-160017198 AACAGCAAAGTCTACATATTTGG + Intronic
965247650 3:166294832-166294854 TTGAGAAGAGTCTATATTCTTGG - Intergenic
965767923 3:172151273-172151295 TTTGGTAAAGTCTACACTTTGGG + Intronic
967277863 3:187794364-187794386 TTGAGCCAAGTCTTCAATTGTGG - Intergenic
969347784 4:6580155-6580177 TTGAGCAAAGTCCAGATGTAAGG - Intronic
970416991 4:15868499-15868521 TTTAGCTACATCTACATTTTAGG + Intergenic
971676926 4:29643516-29643538 TTACGCAAAGTATACATTTGGGG + Intergenic
971924559 4:32990542-32990564 TTGTGCAAAATGTACATGTTGGG + Intergenic
973797352 4:54441520-54441542 TTGGGCAACATCTACATTTGAGG + Intergenic
974208598 4:58740585-58740607 TTGAGAAAAGACTCCATTTGTGG - Intergenic
974552050 4:63388862-63388884 TGTAGAAAAGTCTACATTTATGG + Intergenic
974571725 4:63659799-63659821 TTGAGCAGAGTCAAGATTTTTGG + Intergenic
975420759 4:74161168-74161190 TTTAAAAAAATCTACATTTTTGG + Intronic
977810754 4:101353088-101353110 ATGAGCTAAGTTTATATTTTAGG + Intergenic
978125432 4:105130071-105130093 TTGAGCCAATTCCACATTTAAGG + Intergenic
978831520 4:113091244-113091266 TTGAGGGAAGTCAAAATTTTAGG - Intronic
980833507 4:138160555-138160577 GTGGGCAAAATATACATTTTAGG + Intergenic
982136444 4:152278113-152278135 TTGAGCACAGTCTACATGCCAGG + Intergenic
983546341 4:168968441-168968463 TTGACAAAAGTATACATTTATGG - Intronic
983794283 4:171840791-171840813 TTCAGAAAAATCTAGATTTTAGG - Intronic
984231148 4:177100800-177100822 TTCAGCAAAGACAAAATTTTTGG - Intergenic
985846166 5:2350543-2350565 TTGAGCAAACTTTTCATTTCAGG - Intergenic
988655959 5:33211879-33211901 TTGAGCACTGTTGACATTTTGGG + Intergenic
990898463 5:60724931-60724953 TTGAGGAAGGTCTGAATTTTAGG + Intergenic
991129195 5:63102393-63102415 TTGGCAAAAGTCTACATCTTTGG - Intergenic
992007569 5:72493033-72493055 TTGTGCAGAGGCTACATTTGGGG - Intronic
992263245 5:74991622-74991644 TTGAGCAAAGACTACAAATCAGG + Intergenic
995716824 5:115088513-115088535 TTGACTAAAGTCTACTTTTGGGG + Intergenic
995719035 5:115110438-115110460 TTGTTCAAAGTTTAGATTTTGGG + Intergenic
995727170 5:115193284-115193306 CTGACCAATATCTACATTTTTGG + Intergenic
996938970 5:128981152-128981174 TTTAACAAAGTCTACATTGTAGG - Intronic
999353556 5:150902482-150902504 TTCAGTAAAGTTTACATTTTTGG + Intronic
999698431 5:154206627-154206649 TTTAGCAAAGTGTACATGGTGGG + Intronic
999881142 5:155865513-155865535 TTCAGAAACTTCTACATTTTTGG - Intergenic
1000799766 5:165711304-165711326 TTAAGGAATGTCTAGATTTTAGG + Intergenic
1004215691 6:13702049-13702071 TTGTGAAAAGTGTACATTTTGGG - Intronic
1004991835 6:21146966-21146988 CAGATCCAAGTCTACATTTTTGG + Intronic
1005728446 6:28672302-28672324 TTGGGAAAAGTCTACAGTTCAGG + Intergenic
1007905297 6:45453794-45453816 TTTATGAAAGTCTACATTGTTGG + Intronic
1010184798 6:73131614-73131636 TTGAGAAAAGTAGATATTTTTGG + Intronic
1010304806 6:74307123-74307145 TTAATTAATGTCTACATTTTTGG + Intergenic
1010626973 6:78149538-78149560 TTGAGCAAAATCAACAGTGTAGG + Intergenic
1011676283 6:89737204-89737226 CTGAGCAAAGACTTCTTTTTAGG - Intronic
1011830063 6:91361328-91361350 ATGAGCAAAGCTTGCATTTTAGG - Intergenic
1012068505 6:94580527-94580549 ATGAGAAAAGATTACATTTTAGG + Intergenic
1013327693 6:109064015-109064037 TTGAGCCATGTATACAATTTTGG + Intronic
1013664028 6:112328406-112328428 TTAAGCAAAGGGCACATTTTAGG + Intergenic
1013666059 6:112349947-112349969 TTGAGCAAAGTCTGCACGTGAGG + Exonic
1014069452 6:117164220-117164242 TTGAGAAAAATCTATATTCTGGG + Intergenic
1017742502 6:157419243-157419265 TTAACTAAAGTCTACAGTTTAGG + Intronic
1018232054 6:161684745-161684767 TTCACTAAAGTCTATATTTTAGG + Intronic
1020592698 7:10161827-10161849 TTGAGCAGAGTTTACATTCTTGG - Intergenic
1021031810 7:15746402-15746424 ATCAGCAAAATCAACATTTTTGG + Intergenic
1021031990 7:15748800-15748822 TTGAGCAATTTCTACATGTCAGG + Intergenic
1022020490 7:26395866-26395888 TTGAGAACAGTCAACTTTTTTGG + Intergenic
1023128483 7:36978508-36978530 TTGAGAAACATGTACATTTTTGG - Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024831141 7:53459432-53459454 TTAAGCTGTGTCTACATTTTTGG + Intergenic
1025714191 7:63939704-63939726 TTTATCAAAATCTAGATTTTAGG + Intergenic
1028035739 7:85979444-85979466 TTGAGCAAAGTCTTGACATTTGG - Intergenic
1028242278 7:88435812-88435834 TTTCACAATGTCTACATTTTGGG + Intergenic
1029906009 7:104094014-104094036 TTCAGCCAAGTCTCCAATTTAGG - Intergenic
1031482447 7:122295373-122295395 TTCAGCAAAATCTACATTTTGGG - Intergenic
1033550271 7:142440712-142440734 TTAAGCGGAGGCTACATTTTTGG - Intergenic
1037196182 8:16193244-16193266 TTGAGTAAAGACTCCATGTTTGG + Intronic
1041604510 8:59764862-59764884 TTGAGCCAAATTTACATTCTTGG - Intergenic
1042685256 8:71431662-71431684 TTGAGGAAAGTCTTCTTTTAAGG + Intronic
1044164501 8:88965324-88965346 TTGAGGAATGACTACATTGTAGG - Intergenic
1045298240 8:100890792-100890814 GTGATAAAAGACTACATTTTGGG + Intergenic
1047549660 8:125856442-125856464 ATGATCAAAGTTAACATTTTGGG - Intergenic
1047671338 8:127150312-127150334 TTGAGAAAAGTGTACATTACAGG - Intergenic
1048431254 8:134373526-134373548 TTTTGCAAAGGCCACATTTTTGG + Intergenic
1050701605 9:8345910-8345932 TGGAGCATTATCTACATTTTGGG - Intronic
1050787502 9:9424043-9424065 TTGAGCAAAATATATATCTTTGG - Intronic
1051033797 9:12718295-12718317 TTAAGCAAGTACTACATTTTAGG - Intergenic
1051093814 9:13441664-13441686 TTAAAAAAAGTCTACATCTTTGG + Intergenic
1051515166 9:17922578-17922600 TTGACCAAAAACCACATTTTAGG + Intergenic
1051815905 9:21105240-21105262 TTGAGAAAAGTTTACAATTGTGG + Intergenic
1056038558 9:82635872-82635894 ATGAGAAAAGGCTACATTTCTGG - Intergenic
1057744100 9:97737875-97737897 TTCTACAAAGACTACATTTTGGG - Intergenic
1057974586 9:99591207-99591229 TTGAGCAAAATCTGTATTTCAGG + Intergenic
1058390219 9:104487741-104487763 TTAAGCATAGTCTTCGTTTTTGG + Intergenic
1058938275 9:109789538-109789560 TTGAGCTAACCCTTCATTTTTGG + Intronic
1058949428 9:109889919-109889941 TTCTGCAAAGTCAACTTTTTTGG + Intronic
1059593657 9:115692644-115692666 TTTGGCAAAGTTGACATTTTGGG - Intergenic
1062405046 9:136392259-136392281 TGGAGCCAAGTCTACATGTTTGG - Intronic
1186304441 X:8240474-8240496 TTGAACAAATTCATCATTTTTGG + Intergenic
1188306210 X:28562269-28562291 CAGAGGAATGTCTACATTTTAGG + Intergenic
1188922501 X:35994706-35994728 TTTAGTAAAACCTACATTTTTGG - Intergenic
1188935211 X:36167368-36167390 TTCAGCAAACCCTCCATTTTAGG + Intergenic
1189527208 X:41836065-41836087 TTTAGCAAACTGTACATCTTTGG - Intronic
1194299605 X:92169341-92169363 TTGAGCTAAGACTGAATTTTAGG + Intronic
1194789831 X:98133674-98133696 TTGAGCACAGTTCAGATTTTTGG - Intergenic
1196016667 X:110946856-110946878 TTGAGGAATTTTTACATTTTAGG + Intronic
1199136137 X:144255255-144255277 TTCAGCAATGTCTACACTTGAGG - Intergenic
1199604811 X:149568784-149568806 TTTAGCAACGGCTAGATTTTGGG - Intergenic
1199796817 X:151206499-151206521 TTGAGAAAAACCTACATGTTGGG - Intergenic
1200617249 Y:5394502-5394524 TTGAGCTAAGACTGAATTTTAGG + Intronic