ID: 951352489

View in Genome Browser
Species Human (GRCh38)
Location 3:21623468-21623490
Sequence CTTGATTTTCTTGTAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3089
Summary {0: 1, 1: 0, 2: 10, 3: 221, 4: 2857}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951352489_951352494 28 Left 951352489 3:21623468-21623490 CCAGTCTTTACAAGAAAATCAAG 0: 1
1: 0
2: 10
3: 221
4: 2857
Right 951352494 3:21623519-21623541 TGTAGTCTTAGCTAGTCAGGAGG 0: 2
1: 249
2: 6312
3: 64494
4: 189815
951352489_951352491 -3 Left 951352489 3:21623468-21623490 CCAGTCTTTACAAGAAAATCAAG 0: 1
1: 0
2: 10
3: 221
4: 2857
Right 951352491 3:21623488-21623510 AAGAAATTATCCAGGCATGATGG 0: 1
1: 45
2: 1520
3: 22533
4: 85799
951352489_951352493 25 Left 951352489 3:21623468-21623490 CCAGTCTTTACAAGAAAATCAAG 0: 1
1: 0
2: 10
3: 221
4: 2857
Right 951352493 3:21623516-21623538 GCTTGTAGTCTTAGCTAGTCAGG 0: 1
1: 16
2: 565
3: 10432
4: 110008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951352489 Original CRISPR CTTGATTTTCTTGTAAAGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr