ID: 951352491

View in Genome Browser
Species Human (GRCh38)
Location 3:21623488-21623510
Sequence AAGAAATTATCCAGGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109898
Summary {0: 1, 1: 45, 2: 1520, 3: 22533, 4: 85799}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951352487_951352491 20 Left 951352487 3:21623445-21623467 CCATCCTGGACAACATAGCAAGA 0: 18
1: 887
2: 10064
3: 49675
4: 135869
Right 951352491 3:21623488-21623510 AAGAAATTATCCAGGCATGATGG 0: 1
1: 45
2: 1520
3: 22533
4: 85799
951352489_951352491 -3 Left 951352489 3:21623468-21623490 CCAGTCTTTACAAGAAAATCAAG 0: 1
1: 0
2: 10
3: 221
4: 2857
Right 951352491 3:21623488-21623510 AAGAAATTATCCAGGCATGATGG 0: 1
1: 45
2: 1520
3: 22533
4: 85799
951352488_951352491 16 Left 951352488 3:21623449-21623471 CCTGGACAACATAGCAAGACCAG 0: 1
1: 44
2: 1005
3: 9325
4: 32616
Right 951352491 3:21623488-21623510 AAGAAATTATCCAGGCATGATGG 0: 1
1: 45
2: 1520
3: 22533
4: 85799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951352491 Original CRISPR AAGAAATTATCCAGGCATGA TGG Intronic
Too many off-targets to display for this crispr