ID: 951352494

View in Genome Browser
Species Human (GRCh38)
Location 3:21623519-21623541
Sequence TGTAGTCTTAGCTAGTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260872
Summary {0: 2, 1: 249, 2: 6312, 3: 64494, 4: 189815}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951352489_951352494 28 Left 951352489 3:21623468-21623490 CCAGTCTTTACAAGAAAATCAAG 0: 1
1: 0
2: 10
3: 221
4: 2857
Right 951352494 3:21623519-21623541 TGTAGTCTTAGCTAGTCAGGAGG 0: 2
1: 249
2: 6312
3: 64494
4: 189815
951352492_951352494 -2 Left 951352492 3:21623498-21623520 CCAGGCATGATGGTGCATGCTTG 0: 15
1: 553
2: 6277
3: 19577
4: 53278
Right 951352494 3:21623519-21623541 TGTAGTCTTAGCTAGTCAGGAGG 0: 2
1: 249
2: 6312
3: 64494
4: 189815

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951352494 Original CRISPR TGTAGTCTTAGCTAGTCAGG AGG Intronic
Too many off-targets to display for this crispr