ID: 951355349

View in Genome Browser
Species Human (GRCh38)
Location 3:21660421-21660443
Sequence GTTGGTATAAAGATTAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 2, 2: 20, 3: 137, 4: 698}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951355349_951355353 -5 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355353 3:21660439-21660461 CCAACTGGAAATAGAGCCATGGG 0: 1
1: 0
2: 1
3: 15
4: 126
951355349_951355354 -4 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355354 3:21660440-21660462 CAACTGGAAATAGAGCCATGGGG 0: 1
1: 0
2: 1
3: 14
4: 180
951355349_951355351 -6 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355351 3:21660438-21660460 ACCAACTGGAAATAGAGCCATGG 0: 1
1: 0
2: 2
3: 8
4: 221
951355349_951355359 8 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355359 3:21660452-21660474 GAGCCATGGGGACGGGGGCATGG 0: 1
1: 0
2: 2
3: 49
4: 476
951355349_951355355 0 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355355 3:21660444-21660466 TGGAAATAGAGCCATGGGGACGG 0: 1
1: 0
2: 3
3: 29
4: 336
951355349_951355356 1 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355356 3:21660445-21660467 GGAAATAGAGCCATGGGGACGGG 0: 1
1: 0
2: 3
3: 21
4: 493
951355349_951355358 3 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355358 3:21660447-21660469 AAATAGAGCCATGGGGACGGGGG 0: 1
1: 0
2: 0
3: 12
4: 161
951355349_951355357 2 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355357 3:21660446-21660468 GAAATAGAGCCATGGGGACGGGG 0: 1
1: 0
2: 1
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951355349 Original CRISPR GTTGGTATAAAGATTAAATG AGG (reversed) Intronic