ID: 951355355

View in Genome Browser
Species Human (GRCh38)
Location 3:21660444-21660466
Sequence TGGAAATAGAGCCATGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951355349_951355355 0 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355355 3:21660444-21660466 TGGAAATAGAGCCATGGGGACGG 0: 1
1: 0
2: 3
3: 29
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951355355 Original CRISPR TGGAAATAGAGCCATGGGGA CGG Intronic
900743452 1:4344343-4344365 TGCAAACGGAGCCATGGGCAGGG - Intergenic
900780545 1:4614885-4614907 GGCAAAGAGAGCAATGGGGAGGG + Intergenic
900891708 1:5454443-5454465 GGGAAGTAGAGAAATGGGGAGGG - Intergenic
901133376 1:6976846-6976868 AGGTAATAGAACCATGGGGACGG + Intronic
901549470 1:9984872-9984894 TAGAGATTGAGCCATGGGGATGG + Exonic
901877607 1:12175716-12175738 AGGAAATTGAGCCAAGGGGTGGG - Intronic
902855271 1:19198743-19198765 TGGAAAAGGTGCCATGGGGGTGG + Intronic
903221152 1:21870360-21870382 TGGAGCTAGAGCCATGGGCAGGG + Intronic
905225467 1:36475800-36475822 TGGAAATGGAAGGATGGGGACGG + Intronic
907373371 1:54017295-54017317 TGGCGATAGAGACATGAGGAGGG - Intronic
908656670 1:66395526-66395548 TAGATGTAGAGCCCTGGGGAGGG - Intergenic
909555838 1:76952897-76952919 TGGAAATAAAACTATGGAGATGG - Intronic
913189066 1:116398101-116398123 TGGAAACAGAGCAACGGTGATGG + Intronic
913501988 1:119480113-119480135 AGGAAATGGTGCCAAGGGGATGG - Intergenic
914240358 1:145849032-145849054 AAGAAATAGAGCCATGGGTTTGG + Exonic
914430121 1:147613096-147613118 TGGAAATGGTGCCAAGGGCAAGG + Exonic
916278916 1:163026725-163026747 TGGATATAGATTGATGGGGAGGG + Intergenic
916568112 1:166000108-166000130 AGAAGATAGAGCTATGGGGATGG + Intergenic
919761146 1:201099049-201099071 TGAAAATAGAGGCAGTGGGAGGG - Intronic
920037177 1:203073791-203073813 TGGAAATGGAGATAAGGGGAAGG + Intronic
920690314 1:208141683-208141705 TGCAGAGAGAGCCATGGTGAAGG - Intronic
921133704 1:212241678-212241700 TGGAAATATGGCCATGGAAATGG - Intergenic
921411060 1:214836675-214836697 TGGAAATAGAGGAAAGGGGTAGG - Intergenic
921970305 1:221141193-221141215 AGGAAATTGAATCATGGGGATGG + Intergenic
922886788 1:229026566-229026588 TTGAAATATAGCCCTGGGGAAGG - Intergenic
1062768672 10:83420-83442 TGGAGATAGAGCAAGGTGGAGGG - Intergenic
1062876335 10:945776-945798 TTGAAAGAGAGCCATGGTGGGGG - Intergenic
1063387274 10:5623889-5623911 TGGGAATTTAGCCATGGGGCTGG - Intergenic
1065178977 10:23106194-23106216 TGGAAATGGATCCATGGAAAGGG - Intronic
1065184757 10:23160860-23160882 AGGCAAAAGAGACATGGGGAAGG + Intergenic
1066678650 10:37914807-37914829 TGGAAACACAGCAATGGGGCCGG - Intergenic
1067270997 10:44791227-44791249 TGGAAAGAGAGCAAGGGGGAAGG - Intergenic
1067794179 10:49308679-49308701 TGGAGATATAGCCATGTGCAGGG - Intronic
1068444981 10:57109047-57109069 AGGTAATTGAACCATGGGGATGG + Intergenic
1068583203 10:58766257-58766279 TGGATATAGTGCCATGGGGTGGG + Intronic
1070026463 10:72636714-72636736 AGGAGATAAAGCCATGGTGAAGG - Intergenic
1070567443 10:77614646-77614668 TGGAAACTGAGGCATGAGGAGGG + Intronic
1071294192 10:84207343-84207365 TGGGAATAGAGCACTTGGGAAGG + Intronic
1073673410 10:105617786-105617808 TGGAAAGAAGGCCATGGGAAAGG - Intergenic
1075004658 10:118821137-118821159 TGCAGAAACAGCCATGGGGAAGG + Intergenic
1075059164 10:119242652-119242674 AGGAAATTGAATCATGGGGATGG + Intronic
1075263505 10:120981938-120981960 TGGAGACAGAGCCCTGGGGGCGG - Intergenic
1076498329 10:130914141-130914163 TCTAAATAGAGCCATGGGGATGG - Intergenic
1078007494 11:7543427-7543449 TGGAAATCAAGGCCTGGGGAAGG - Intronic
1079603566 11:22340802-22340824 TTGAACTAGAGCCCTGGGGCGGG + Intronic
1079915509 11:26364693-26364715 TGAAAATAGCACCAAGGGGATGG + Intronic
1080341867 11:31273984-31274006 AGGTAATTGAGTCATGGGGATGG - Intronic
1081301577 11:41458954-41458976 AAAAAATAGAGCTATGGGGAGGG + Intronic
1082646232 11:55730175-55730197 GAGAAATAGAACCAAGGGGATGG + Intergenic
1082820827 11:57543661-57543683 TGGAAAAAGAGCCAGAGGGAGGG + Exonic
1083431160 11:62614202-62614224 TGGAGATAGAGGCCTGGGGGAGG - Intronic
1084097410 11:66920746-66920768 TGGAAATACAGGCATGAGGCTGG + Intronic
1084174849 11:67417768-67417790 TGGAACCAGAGCCTAGGGGAAGG - Intronic
1084465269 11:69319662-69319684 TGCAAATAGATCCATGTGGCAGG - Intronic
1085718467 11:78893202-78893224 TGGAAATAGAGCCACTCTGAGGG - Intronic
1086924904 11:92629794-92629816 TGGAATGAGAGACATGGGGCAGG - Intronic
1087153498 11:94879475-94879497 TTGAACTAAGGCCATGGGGATGG - Intergenic
1088912672 11:114203846-114203868 TGAAAATGGAGGAATGGGGAGGG - Intronic
1089215844 11:116834259-116834281 TGGAGATGGGGACATGGGGATGG + Intergenic
1089337539 11:117735288-117735310 TGGCAGCAGAGCCATGGGGCTGG + Intronic
1090261436 11:125323563-125323585 AGGAAATAGAGCCCTGAGAAGGG + Intronic
1090957164 11:131523880-131523902 TGAAAATAGAGAAATGGGGTGGG + Intronic
1090984647 11:131755370-131755392 TGAAAATACAGTCAAGGGGAAGG - Intronic
1091361379 11:134980977-134980999 TGGGGACAGAGTCATGGGGAGGG + Intergenic
1092284892 12:7123040-7123062 TGGGAAAAGAGCCTGGGGGAAGG - Intergenic
1096317961 12:50585274-50585296 TGGAAATAGAGCATTGGGCAAGG + Intronic
1097068326 12:56336970-56336992 AGGAAGTAGAGCCTGGGGGATGG - Intronic
1097395740 12:59072534-59072556 TGTACAGAGAGCCATGGGCATGG - Intergenic
1098192837 12:67968359-67968381 TGGAAACCGAGCCATGGAAAAGG - Intergenic
1098612986 12:72485204-72485226 AGCAACTTGAGCCATGGGGATGG - Intronic
1101404028 12:104412489-104412511 AGGTAATTGAGCCATGGGGGCGG + Intergenic
1102396000 12:112586359-112586381 GGCAAATATAGCCGTGGGGAGGG + Intronic
1102756819 12:115348317-115348339 TATAAATAGAGACATGGCGACGG + Intergenic
1103024698 12:117564039-117564061 TGGTGTGAGAGCCATGGGGAAGG - Intronic
1105790233 13:23791273-23791295 TGAAAAGAGAGCTGTGGGGATGG - Intronic
1105922123 13:24973039-24973061 TCAAAATAGAGCCATGGGCCAGG + Intergenic
1105941355 13:25150792-25150814 TGGAAAGAGAGCCAGGGAGTGGG - Intergenic
1107386960 13:39921107-39921129 TTGAAATATAGCCAAAGGGAAGG - Intergenic
1109332007 13:60941955-60941977 TGTAGATAAAGACATGGGGAGGG + Intergenic
1114169740 14:20260239-20260261 TAGAAATAGATCCAGGGTGATGG - Intronic
1115502437 14:34061187-34061209 GGGAAAGAGATACATGGGGAAGG + Intronic
1116080382 14:40163334-40163356 AGGTAATTGAGCCATGGGGGTGG + Intergenic
1116378282 14:44231720-44231742 TGGAAAAAGACCCCTTGGGAAGG - Intergenic
1117988119 14:61408468-61408490 TGGAGATAGGGGCATGGGTAGGG + Intronic
1118046358 14:61975636-61975658 AGGTAATTGAACCATGGGGATGG - Intergenic
1119102169 14:71889821-71889843 TGAGAATAGTGCCAAGGGGATGG - Intergenic
1119174257 14:72557565-72557587 TGGAATTAGAGGCCTGGGGTGGG - Intronic
1120695138 14:87636377-87636399 TTGAAATAGAGCACTGGGGTGGG - Intergenic
1121533595 14:94675963-94675985 GGGTAATAGAGACAAGGGGAGGG + Intergenic
1121823930 14:96995046-96995068 TGGAAGCAGAGCCATGGGAGCGG + Intergenic
1122275726 14:100589769-100589791 ACGAGATTGAGCCATGGGGATGG - Intergenic
1122448103 14:101782784-101782806 GGGAAAGAGAGGCAGGGGGAAGG - Intronic
1123610406 15:22086963-22086985 TGGAAATAGATGGATGGGGCAGG + Intergenic
1124394612 15:29290396-29290418 TGAATATAGAGTCATGGGAAAGG - Intronic
1124885005 15:33677208-33677230 TGGAAAGGGGGCCATGGGGATGG + Intronic
1126303029 15:47221287-47221309 GGGAGCTGGAGCCATGGGGAGGG - Intronic
1126463268 15:48936508-48936530 TGGGAATAGAATCTTGGGGATGG - Intronic
1127149358 15:56057609-56057631 TTGAGACTGAGCCATGGGGAAGG - Intergenic
1127212284 15:56785512-56785534 TGGAAATGCAGCCAAGGGCAGGG + Intronic
1127369221 15:58321583-58321605 TTAAAGTTGAGCCATGGGGATGG + Intronic
1127540026 15:59928206-59928228 GGGAAACAGGGCCATGGGGTGGG - Intergenic
1128729256 15:70009635-70009657 AGGAAATAGCTCCATGAGGAAGG + Intergenic
1129151250 15:73689268-73689290 TGGAACTAGAGGCATGTGCAGGG - Intronic
1129836984 15:78714863-78714885 TGCAAATACAGCCATGCAGAGGG - Intronic
1129983398 15:79895351-79895373 TGGAAACATAGCCTTGGGGAGGG - Intronic
1130678528 15:85975785-85975807 TGTAAATATAGCAATGTGGATGG - Intergenic
1131126582 15:89863343-89863365 GGGCAGTAGAGCCATGGGAAGGG + Intronic
1133622799 16:7542556-7542578 TAGAAATAGAGGGATGGGGCCGG + Intronic
1133813473 16:9178820-9178842 TGGAAGCAGAGCCGTGGGTACGG + Intergenic
1135725860 16:24853553-24853575 AAGAAATAGAGCCAGAGGGAGGG + Intronic
1136067619 16:27769473-27769495 AGGAAATTGAGGCATAGGGAAGG + Intronic
1138263348 16:55641515-55641537 AGGAAATAGAGCTGTGGGGTAGG + Intergenic
1138589358 16:57991305-57991327 GTGAAATGGAGCCAAGGGGAGGG - Intergenic
1138741388 16:59314772-59314794 TGGAAATATGGCCAGGGTGAAGG + Intergenic
1138849411 16:60608231-60608253 TGGAAAGAGGGCCTTGGGGATGG + Intergenic
1139379417 16:66521238-66521260 TGCACATGGAGACATGGGGAGGG + Intronic
1140661154 16:77192212-77192234 TGTAAATGGAGTCATTGGGAAGG + Intronic
1141506329 16:84480931-84480953 TTGAGAAAGAGCCATGGGGTGGG - Intronic
1141535371 16:84676164-84676186 TGTACATAGATCCATGGGCAGGG + Intergenic
1143416808 17:6756514-6756536 TGGAAAGGGAGCCGTGGGGCGGG + Intronic
1144240894 17:13310412-13310434 TGCAACTAGAGGCATGGGGAAGG + Intergenic
1144960514 17:19041765-19041787 GAGAGATAGAGCCACGGGGATGG + Intronic
1144974646 17:19132759-19132781 GAGAGATAGAGCCACGGGGATGG - Intronic
1145122905 17:20276916-20276938 TGGAGGAAGAGCCATGGGCAAGG + Intronic
1145906646 17:28520096-28520118 AGGAAACTGAGGCATGGGGAAGG + Intronic
1151093285 17:71466775-71466797 TGGAAAAAGCTCCATGGAGAAGG - Intergenic
1151869697 17:76827921-76827943 TGGAAATTGGCCCAAGGGGAAGG - Intergenic
1152000269 17:77640918-77640940 TGGGAAGAGTTCCATGGGGAGGG + Intergenic
1152096097 17:78272571-78272593 TGGACAGAGAGGCATGGAGAGGG - Intergenic
1152961553 18:83251-83273 TGGAGATAGAGCAAGGTGGAGGG - Intergenic
1152991089 18:364471-364493 TAGGAATAGAGCCAAGAGGAAGG - Intronic
1153709986 18:7788825-7788847 TGTTAATATAGCCATGGGAAAGG + Intronic
1153937498 18:9942790-9942812 TGGGAACAGTGTCATGGGGATGG + Intronic
1154390768 18:13934351-13934373 TGGGTAAAGAGCCCTGGGGAGGG - Intergenic
1154493923 18:14941947-14941969 TGGGGACAGAGTCATGGGGAGGG - Intergenic
1155202149 18:23526777-23526799 TGGAATCAGAGCAAGGGGGAAGG - Intronic
1156693292 18:39734833-39734855 TTCAAATAGAGCCCTGTGGATGG + Intergenic
1157281217 18:46347450-46347472 TGGAAAGAGAGTCACGTGGAGGG + Intronic
1157403439 18:47404819-47404841 AGGAACCAGAGCCATGGAGAGGG - Intergenic
1157571703 18:48716586-48716608 TAGAAACAGAGCCATGTGGGTGG + Intronic
1158838846 18:61361206-61361228 TGGTAACAGAGCTAGGGGGAAGG + Intronic
1162008458 19:7795502-7795524 TGCAAATAGTGCCGTGGTGATGG - Intergenic
1163046874 19:14649634-14649656 TGGAAAGAGAGAGATGGGGAGGG - Intronic
1163046886 19:14649726-14649748 TGGAAAGAGAGAGATGGGGAGGG - Intronic
1163046898 19:14649818-14649840 TGGAAAGAGAGAGATGGGGAGGG - Intronic
1163046910 19:14649910-14649932 TGGAAAGAGAGAGATGGGGAGGG - Intronic
1163046922 19:14650002-14650024 TGGAAAGAGAGAGATGGGGAGGG - Intronic
1163343639 19:16726255-16726277 TAAAAATAGAGCCATGGGCCAGG - Intronic
1163345979 19:16742518-16742540 TGGAAACAGGGGCCTGGGGATGG - Intronic
1165867071 19:38945654-38945676 TGGAACCAGAGCCTGGGGGAGGG + Intronic
1167396350 19:49231980-49232002 GGGAAAGAAAGCAATGGGGATGG + Intergenic
1167735350 19:51291281-51291303 AGGAAACAGAGCCATAGGGTGGG - Intergenic
1167805292 19:51779014-51779036 TGGTAACACAGCCATTGGGAGGG + Intronic
926053133 2:9757379-9757401 TTTACACAGAGCCATGGGGAAGG - Intergenic
926479191 2:13367605-13367627 TGGCAATAGGGCAATGGGGGTGG + Intergenic
928316347 2:30249598-30249620 GGGAAACAGAGCCACAGGGAGGG + Intronic
928328452 2:30338548-30338570 TGGAAAAAGAGCCAGAGGCAAGG + Intergenic
928444880 2:31324988-31325010 TGAAAATAAAGAAATGGGGAAGG + Intergenic
930887101 2:56338412-56338434 GGGAAATAGCAGCATGGGGAAGG + Intronic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
932849389 2:75170186-75170208 AGGTAATTGAGTCATGGGGATGG + Intronic
933695259 2:85212860-85212882 TCCAAACAGAGACATGGGGAGGG + Intronic
935601484 2:104926906-104926928 TGGACATAGGGACATAGGGAGGG + Intergenic
936014816 2:108950044-108950066 TGGGCATGGTGCCATGGGGAGGG + Intronic
936470657 2:112796023-112796045 AGGAAACAGAGGGATGGGGAGGG + Intergenic
936960135 2:118064601-118064623 TAGAAATAGAGACGGGGGGAAGG - Intergenic
938574636 2:132592540-132592562 TGGATGCAGAGCCATTGGGAGGG + Intronic
941201368 2:162515021-162515043 TAGAAATAGAGCCATTGATAAGG - Intronic
942533535 2:176938388-176938410 TGGAAATAGAAAGTTGGGGAAGG + Intergenic
942734995 2:179099721-179099743 TGGAAATAGTGCCATGAGACAGG + Intergenic
943088972 2:183351657-183351679 TGGGAAAGGAGCAATGGGGAAGG + Intergenic
943507969 2:188785791-188785813 TGTTAATAGAGCCTTAGGGACGG - Intronic
944435551 2:199685321-199685343 TGGAAATAGAGCCTTAGAGTGGG + Intergenic
945016587 2:205524843-205524865 TGGAAATAGTGCCATGGGTTGGG - Intronic
947961231 2:234239935-234239957 AGGGAATAGACCCAAGGGGATGG - Intergenic
948625708 2:239266712-239266734 TGGAAATGGTGACATTGGGAGGG - Intronic
948712186 2:239832062-239832084 AGGTAATTGAGTCATGGGGATGG + Intergenic
949070289 2:242020359-242020381 TGGAGCTGGAGCCTTGGGGAGGG + Intergenic
1168953490 20:1818315-1818337 TAGGAATAGAGAAATGGGGAGGG - Intergenic
1169033996 20:2434918-2434940 TGGAAACAGAGCTATGTGGCAGG - Intergenic
1169902360 20:10566480-10566502 AGGAAGCAGAGTCATGGGGATGG + Intronic
1170505382 20:17020542-17020564 TGGAAATGGGGCCAGCGGGAAGG - Intergenic
1171198599 20:23223283-23223305 GGAAAAGAGAGCCATGGTGAGGG - Intergenic
1171381182 20:24735338-24735360 TAGAAATGGAGCCTTGGTGATGG - Intergenic
1172903310 20:38350554-38350576 GGGAAATAGAACCTTGAGGAAGG - Intronic
1173693649 20:44986958-44986980 TGGAAATATAGCCTTGGGAGTGG + Intronic
1173956509 20:47037190-47037212 AGGTAATTGAGCCATGGGGGTGG - Intronic
1174100300 20:48122017-48122039 TGGAACTGGAGACAGGGGGAGGG - Intergenic
1174153144 20:48500253-48500275 TGGAGCTGGAGCCTTGGGGAAGG - Intergenic
1175327790 20:58141812-58141834 AGGAAATAGAATGATGGGGATGG - Intergenic
1176018948 20:62952926-62952948 TGGAGATGGGGCCGTGGGGAGGG + Intronic
1176664109 21:9668504-9668526 TGGACATAGAGCCAGGTGGGGGG - Intergenic
1176739570 21:10588142-10588164 TCAAAATAGAGCCATGGGCCAGG - Intronic
1177963501 21:27698517-27698539 TGGAAATGGGGAGATGGGGAAGG - Intergenic
1181417633 22:22771908-22771930 TGGACCCAGAGCCCTGGGGATGG - Intronic
1181616799 22:24060488-24060510 GGGAATGAGAGTCATGGGGAGGG + Intronic
1181819228 22:25462681-25462703 GGGAAGTGGAGCCTTGGGGACGG - Intergenic
1182049320 22:27300867-27300889 TGGGTGCAGAGCCATGGGGAGGG - Intergenic
1182349605 22:29691943-29691965 TGGAAGCAGAGCCATGGGGGTGG + Intronic
1183060961 22:35336182-35336204 TGGAAACCAAGCCCTGGGGAGGG - Intronic
1183967020 22:41447941-41447963 GGGACACAGAGCCAGGGGGAGGG + Intergenic
1184542307 22:45134648-45134670 TGGAAAATGAGCCCTGGGCATGG - Intergenic
1185058490 22:48593319-48593341 GGGAAATAGAGGCACGGGGCAGG + Intronic
1185228177 22:49665067-49665089 TGGAAATCCAGCCATGAGGCAGG + Intergenic
949361876 3:3241078-3241100 TGTAAATAAAGACCTGGGGAGGG - Intergenic
949414535 3:3800360-3800382 TGGAAAGAGGGCCAAGAGGAGGG + Intronic
951306868 3:21074532-21074554 TGGAAATGGAGCCCAGGGGGAGG - Intergenic
951355355 3:21660444-21660466 TGGAAATAGAGCCATGGGGACGG + Intronic
953162297 3:40432474-40432496 TGGAGATGGAGCCTTTGGGAGGG - Intergenic
953540564 3:43814222-43814244 TGGGAAAATAACCATGGGGAAGG - Intergenic
953906218 3:46869458-46869480 GGGAAATGGAGGCAAGGGGAGGG - Intronic
953923100 3:46965710-46965732 TGGAGATGGAGCCAGAGGGATGG - Intronic
954221107 3:49154474-49154496 TGGAATTATCACCATGGGGAAGG - Intergenic
955032068 3:55231574-55231596 TGGAAACAGAGCAATGGGGATGG - Intergenic
956195464 3:66649825-66649847 TGGAGATAGAGCCTTGGGTTTGG - Intergenic
957548614 3:81674108-81674130 TGGAGAAAGAGCCAAGGAGATGG - Intronic
958491266 3:94776872-94776894 TGGAGATACAGGGATGGGGATGG - Intergenic
959547183 3:107610708-107610730 TGAAAATAAAGCCAGGGGGGTGG - Intronic
960005992 3:112781779-112781801 AGGGTATAGAGCCATTGGGATGG - Intronic
960179320 3:114556240-114556262 AGGAAATGGACCCATTGGGAGGG - Intronic
961155983 3:124680143-124680165 AGGAAAAGGAGCCCTGGGGAGGG + Intronic
961424687 3:126835709-126835731 TGAAAAGAGAGAGATGGGGAGGG - Intronic
961736887 3:129007636-129007658 AGGAAATAGACCCTTGGGGTTGG + Intronic
962702592 3:138013975-138013997 TGTAAATATGGCCATGGGGGTGG + Intronic
963148109 3:142015672-142015694 TGGAAATAGAGTTGTGGGGTAGG - Intronic
964415783 3:156446116-156446138 TGGACATAAAGGCATGGGGAAGG + Intronic
964700491 3:159560587-159560609 TGGAAAAAGAGACATGGGGAGGG - Intronic
966774055 3:183528582-183528604 TGGAAGTCCAGCCGTGGGGAGGG - Intronic
967092444 3:186146590-186146612 TAAAAATAGAATCATGGGGATGG - Intronic
967851795 3:194088102-194088124 TCCAAGTGGAGCCATGGGGAAGG + Intergenic
967904879 3:194491433-194491455 GTGAAATGGAGCAATGGGGAAGG - Intronic
969391871 4:6896844-6896866 AGGTAATAGAGTCATGGGGGTGG - Intergenic
969502160 4:7559706-7559728 AGGAAATTGAGGCATGGAGAGGG - Intronic
970040305 4:11789329-11789351 TGGCAATATAGCCCAGGGGAAGG + Intergenic
971242579 4:24901899-24901921 TGGGAATAGAGAAAAGGGGATGG - Intronic
972291510 4:37694131-37694153 AGGAAATAGATCCATGGTTAGGG + Intergenic
972300432 4:37780558-37780580 TGGTAATTGAACCATGGGGGTGG - Intergenic
972835643 4:42866848-42866870 TAGAAATTGAGTCATGGGGGTGG + Intergenic
973821501 4:54665662-54665684 TGGAAATAAAGCCAAGAGGAGGG + Intronic
975495380 4:75030763-75030785 TGGGAGTGGAGACATGGGGAAGG - Intronic
978062083 4:104351311-104351333 AGGACACAGAGCCTTGGGGATGG - Intergenic
978309367 4:107369192-107369214 TGGAGATGGAGCCTTTGGGAAGG + Intergenic
979538571 4:121853232-121853254 TGGAAATAGATGAATGTGGATGG - Intronic
979812919 4:125062826-125062848 TGCAAATAGAGCTATGAGTAAGG + Intergenic
979928664 4:126601695-126601717 TGGTATTAAAGCCATGGGGCTGG + Intergenic
980439168 4:132818032-132818054 GGGAAAGAAAGCCATGGGGGCGG - Intergenic
981218641 4:142204614-142204636 TTGAAATAAAGCCATTAGGATGG + Intronic
983975714 4:173931462-173931484 TGAAAACAGAGCCATGGTAAAGG + Intergenic
984405732 4:179327455-179327477 TGCAAATAGAGGAATGGAGATGG + Intergenic
985875303 5:2590117-2590139 TGGGACCAGGGCCATGGGGAAGG + Intergenic
987745272 5:21962993-21963015 AGGAAAAAGAGGCATGGGGTAGG - Intronic
987768030 5:22261332-22261354 TGAAAATAGAGAAATGGTGATGG - Intronic
988172473 5:27676975-27676997 TAGAAATATAGCGATGGAGAAGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991765474 5:69973112-69973134 AGGAAAAAGAGGCATGGGGTAGG - Intergenic
991781848 5:70145045-70145067 AGGAAAAAGAGGCATGGGGTAGG + Intergenic
991844710 5:70848184-70848206 AGGAAAAAGAGGCATGGGGTAGG - Intergenic
991874291 5:71145356-71145378 AGGAAAAAGAGGCATGGGGTAGG + Intergenic
996785029 5:127229234-127229256 TGGAACTAGAGCCAGGGTAAGGG - Intergenic
997666531 5:135634071-135634093 GAGAGATAGAGCCATGGGCAAGG - Intergenic
997756837 5:136407374-136407396 TGGCAAAAGAGCCAAGGGCATGG + Intergenic
999685915 5:154103075-154103097 TGGAAACAGAGGCATGGAGCAGG - Intronic
1000137724 5:158368911-158368933 TGGAAAGAGGACCAAGGGGAGGG - Intergenic
1000635734 5:163641693-163641715 AGGAAATAGAGAAAGGGGGAGGG + Intergenic
1001419890 5:171578490-171578512 TGGAAACCCAGCCATGGGAAAGG + Intergenic
1002406985 5:179042437-179042459 GGGAAGGAGAGACATGGGGAGGG + Intergenic
1002838298 6:884075-884097 TGAAAATAGGGCACTGGGGAAGG + Intergenic
1005057119 6:21739817-21739839 TGGAAGTAGAGAAATGGGGCTGG + Intergenic
1005140151 6:22622681-22622703 TGGTAATACAGCAATGGGGGTGG + Intergenic
1005420298 6:25641630-25641652 TGGAGATAGGGCCTTGAGGAAGG - Intergenic
1005683381 6:28228531-28228553 TGGAGATAGGGCCTTGAGGAAGG - Intronic
1006167487 6:32073576-32073598 TGGAAGAAGGGCCATGGGGTGGG + Intronic
1007341765 6:41195106-41195128 TGAAAAGAGAGAGATGGGGATGG - Intronic
1011649511 6:89492945-89492967 TGGAATTTGGGGCATGGGGAAGG - Intronic
1011741121 6:90361846-90361868 TGGAAATACAGCCTTGGAGATGG - Intergenic
1011794119 6:90933999-90934021 TGGAAATAGAAGCCTGGGGCTGG + Intergenic
1011902679 6:92319670-92319692 AGGAAAAAGAGCCAGGAGGAAGG - Intergenic
1012634484 6:101519236-101519258 TGGAAAAAGATTCATGGAGAGGG + Intronic
1012661056 6:101892341-101892363 TGCAAATAGAGGCATATGGATGG + Intronic
1012674797 6:102101827-102101849 TGGAAATAGAGCCTGGTGGGAGG - Intergenic
1013259700 6:108429448-108429470 AGGAAATTGAGTCATGGGGATGG - Intronic
1014074230 6:117218280-117218302 TGGAGATAGAGCCTTCAGGAAGG - Intergenic
1014460566 6:121689941-121689963 TGGAAAAAGGGAGATGGGGAAGG - Intergenic
1015443507 6:133275389-133275411 TGGAACTAGAGGCAGTGGGAGGG + Intronic
1015806790 6:137118084-137118106 TGGAAATAGAGGGAAGTGGATGG + Intergenic
1015971180 6:138743839-138743861 TAGAAATAGAGACATGGGCCTGG - Intergenic
1016612636 6:146009786-146009808 TGGAAAAGGAGCCATGCTGAGGG - Intergenic
1020839169 7:13193446-13193468 TGGAAGTAGAGACAAGTGGAAGG + Intergenic
1021206528 7:17787330-17787352 CAGAAAAAGAGCCATGAGGAGGG + Intergenic
1021280129 7:18707044-18707066 TGGAAATAGAGCCAAGAGCTAGG + Intronic
1021688392 7:23209900-23209922 AGCAATAAGAGCCATGGGGATGG + Intergenic
1022055236 7:26724346-26724368 TGGAAATAATGTCATTGGGAGGG - Intronic
1023393389 7:39731513-39731535 TGGTAATAGCGTCATGGGCAAGG - Intergenic
1023757230 7:43431277-43431299 TGGAAATAGAGGCCTGGGCATGG - Intronic
1024505173 7:50156637-50156659 TGGAAATAGAGCCTGGGATATGG - Intronic
1026122286 7:67548409-67548431 AGGTAATTGAGTCATGGGGATGG + Intergenic
1027673710 7:81133369-81133391 AGGTAATAGAATCATGGGGAAGG + Intergenic
1028254892 7:88582848-88582870 TGGAAAAAGAGCCATTTGAAAGG - Intergenic
1028429944 7:90735599-90735621 TGTAAACAAAGCCATCGGGAAGG - Intronic
1028968756 7:96832615-96832637 TGGAAATTGAGCCTTTAGGAAGG - Intergenic
1028984746 7:97000922-97000944 TGGGAATGGAGTCATGGAGAAGG + Intergenic
1029549563 7:101230510-101230532 AGGAAAGGGAGCAATGGGGATGG + Intergenic
1031912891 7:127536146-127536168 TGCAAATAGTGCCATGAGAATGG - Intergenic
1032127483 7:129205458-129205480 TGGGAAGAGAGCCAGAGGGAAGG + Intronic
1032463587 7:132129427-132129449 TGGGGATGGAGCCATGGAGATGG + Exonic
1032521351 7:132547846-132547868 TTGCAAAAGAGCCCTGGGGATGG + Intronic
1033365751 7:140671888-140671910 TGGGAAGATAGACATGGGGAGGG + Intronic
1034063454 7:148114202-148114224 TAGAAATAAAGCCATGGATAAGG + Intronic
1036527204 8:9546460-9546482 AGGTAATTGAGTCATGGGGATGG - Intergenic
1037513615 8:19608325-19608347 TGGAAGTAGCGGTATGGGGAGGG + Intronic
1037827947 8:22170548-22170570 TGGACATAGAGCAAAGGGCAAGG - Intronic
1038923599 8:32113295-32113317 GGGAAATAGAGACAGGGGAAAGG - Intronic
1039818712 8:41117633-41117655 TGGAATGAGAGCTATGGAGAAGG - Intergenic
1041654879 8:60338983-60339005 TGGGAATGGAGAGATGGGGATGG - Intergenic
1041819076 8:62009215-62009237 AGGAAATAGAGACATTGAGAAGG + Intergenic
1042444357 8:68866890-68866912 TTCAAATAGAGCAATAGGGACGG + Intergenic
1042997060 8:74712300-74712322 TGGAACTTGAGCAATGGTGAAGG + Intronic
1044328844 8:90892932-90892954 TGGAACTAGAGAGATGGGGAGGG - Intronic
1044938260 8:97313829-97313851 TGGTAAGAGAGCCATGAGCAAGG - Intergenic
1045296353 8:100874737-100874759 TGGAAATAAGGCCTTGGTGATGG + Intergenic
1045860608 8:106811646-106811668 TTTAAATTGAGCCCTGGGGAAGG - Intergenic
1047768765 8:128013180-128013202 TGGAAACAGAGGCACAGGGAAGG - Intergenic
1047952701 8:129948374-129948396 TGTAAATGGAGCCATGGGCTTGG - Intronic
1048161956 8:132029507-132029529 TGGAAATAGAGTCTTAAGGAAGG + Intronic
1048606962 8:135978985-135979007 TGGAAACTGAGCTGTGGGGAAGG + Intergenic
1048918558 8:139207075-139207097 TGGCAATAGACACATGGGCAGGG + Intergenic
1050216480 9:3331056-3331078 GGGAAAGAGAGATATGGGGAGGG - Intronic
1050418848 9:5441163-5441185 TGGAGCTGGAGCCATGGAGAAGG - Intergenic
1051186996 9:14470776-14470798 TGGACAAAGAGCCAGGGGAACGG + Intergenic
1051634814 9:19172050-19172072 TAGAAATAGAACTATGGGGTTGG - Intergenic
1051813893 9:21081723-21081745 TGGAAATGGAGCCAAAGGAATGG + Intergenic
1052696166 9:31881751-31881773 AGGAAATAGAGCCAGGAGGAAGG - Intergenic
1052965729 9:34339233-34339255 TGGGAATTAAGCCTTGGGGAGGG - Intronic
1053440109 9:38109075-38109097 AGAGAATAGAGCTATGGGGAGGG + Intergenic
1053788154 9:41667104-41667126 TGGTACTAGAGCCCTGGAGAGGG - Intergenic
1054176431 9:61878443-61878465 TGGTACTAGAGCCCTGGAGAGGG - Intergenic
1054661107 9:67702365-67702387 TGGTACTAGAGCCCTGGAGAGGG + Intergenic
1054793390 9:69276553-69276575 TTGAAATAGAGCAAGGGCGACGG + Intergenic
1056297944 9:85211670-85211692 TGGAAACAGAGCTAAGAGGATGG + Intergenic
1056654821 9:88500637-88500659 TGGAAATTGAGGCAGAGGGATGG + Intergenic
1056703668 9:88933148-88933170 TGGAAATATAGCTATAGAGATGG + Intergenic
1056765426 9:89441946-89441968 TGTAAACACAGCCATGGGGATGG - Intronic
1056817311 9:89811401-89811423 TGGAAGTACAGACATGGGGATGG + Intergenic
1056853020 9:90100155-90100177 TGGGAAGAGGGCCAAGGGGAGGG + Intergenic
1057195024 9:93111994-93112016 CGGAGATGGAGCCCTGGGGAGGG - Intronic
1059911357 9:119047666-119047688 TAGAAGGAAAGCCATGGGGAGGG - Intergenic
1060508222 9:124214353-124214375 TGGGAGGAGAGCCATGGGGGAGG + Intergenic
1061110449 9:128565929-128565951 AGGAAATTGAGGCATGGAGAGGG + Intronic
1061200995 9:129138517-129138539 TGGAAACTGGGGCATGGGGATGG - Intronic
1061477131 9:130875538-130875560 GGGAAATAAAGACATGGAGAGGG - Intronic
1061755255 9:132807883-132807905 TAGGAATGGAGCTATGGGGAAGG + Intronic
1062736598 9:138140867-138140889 TGGAGATAGAGCAAGGTGGAGGG + Intergenic
1203661991 Un_KI270753v1:53248-53270 TGGACATAGAGCCAGGTGGGGGG + Intergenic
1186420948 X:9425972-9425994 TGGGAATAGAAGAATGGGGAAGG + Intergenic
1187212167 X:17242466-17242488 TGGTAATAGTGACATAGGGATGG - Intergenic
1188479177 X:30620058-30620080 TGGAAAGAGGGTCATAGGGAAGG - Intergenic
1189335096 X:40166363-40166385 AGGAAATAGAGCCGGGGTGAAGG - Intronic
1190291728 X:48997488-48997510 AGGAGAAAGAGACATGGGGAGGG + Intronic
1190478809 X:50854120-50854142 TGGAAATGAAGAGATGGGGAAGG - Intergenic
1192196510 X:69032339-69032361 AGGAAATGGAGCCTTGGAGAGGG - Intergenic
1192578403 X:72260860-72260882 TAGAGAGACAGCCATGGGGACGG - Intronic
1192829879 X:74740695-74740717 TGGAGATTGGGCCTTGGGGAAGG - Exonic
1194462939 X:94195688-94195710 AGGTAATTGAGTCATGGGGATGG + Intergenic
1194583762 X:95708144-95708166 TGAAAATATAGCCATGAGGGAGG - Intergenic
1194848200 X:98838576-98838598 AGGAAATAAAGCCATGGGTCTGG - Intergenic
1195311710 X:103638460-103638482 TGCAAATAGAGGCAAGGAGAGGG + Intergenic
1196396785 X:115272270-115272292 TGGAAAAAGAGCCTTGAGGGTGG - Intergenic
1196744183 X:119054587-119054609 TGGAAAAACATCCATGGGAATGG + Intergenic
1200080727 X:153575168-153575190 TGGGCAAAGAGCTATGGGGAGGG + Intronic