ID: 951355355

View in Genome Browser
Species Human (GRCh38)
Location 3:21660444-21660466
Sequence TGGAAATAGAGCCATGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951355349_951355355 0 Left 951355349 3:21660421-21660443 CCTCATTTAATCTTTATACCAAC 0: 1
1: 2
2: 20
3: 137
4: 698
Right 951355355 3:21660444-21660466 TGGAAATAGAGCCATGGGGACGG 0: 1
1: 0
2: 3
3: 29
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951355355 Original CRISPR TGGAAATAGAGCCATGGGGA CGG Intronic