ID: 951356431

View in Genome Browser
Species Human (GRCh38)
Location 3:21672481-21672503
Sequence TCCTCTCTGTGGTCATAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951356431_951356436 6 Left 951356431 3:21672481-21672503 CCTGCTTATGACCACAGAGAGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 951356436 3:21672510-21672532 TGAGAATGGGAGTATGAGTCAGG 0: 1
1: 0
2: 3
3: 19
4: 370
951356431_951356439 27 Left 951356431 3:21672481-21672503 CCTGCTTATGACCACAGAGAGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 951356439 3:21672531-21672553 GGGCAATTGGAGCTCCATTCTGG 0: 1
1: 0
2: 0
3: 4
4: 88
951356431_951356435 -7 Left 951356431 3:21672481-21672503 CCTGCTTATGACCACAGAGAGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 951356435 3:21672497-21672519 GAGAGGAATGAGGTGAGAATGGG 0: 1
1: 0
2: 2
3: 52
4: 544
951356431_951356438 14 Left 951356431 3:21672481-21672503 CCTGCTTATGACCACAGAGAGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 951356438 3:21672518-21672540 GGAGTATGAGTCAGGGCAATTGG 0: 1
1: 0
2: 2
3: 10
4: 269
951356431_951356434 -8 Left 951356431 3:21672481-21672503 CCTGCTTATGACCACAGAGAGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 951356434 3:21672496-21672518 AGAGAGGAATGAGGTGAGAATGG 0: 1
1: 0
2: 9
3: 127
4: 1392
951356431_951356437 7 Left 951356431 3:21672481-21672503 CCTGCTTATGACCACAGAGAGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 951356437 3:21672511-21672533 GAGAATGGGAGTATGAGTCAGGG 0: 1
1: 0
2: 1
3: 29
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951356431 Original CRISPR TCCTCTCTGTGGTCATAAGC AGG (reversed) Intronic
900612831 1:3551599-3551621 CCCTCTCAGTGGTCACAGGCTGG + Intronic
900766297 1:4508061-4508083 CCCTCTCTGCGGTCAAAGGCCGG + Intergenic
901924431 1:12556907-12556929 GCCTCTCTGTGGTCAGGACCCGG + Intergenic
903878117 1:26490274-26490296 TCAAGTCTGAGGTCATAAGCAGG + Intergenic
905370742 1:37481508-37481530 TCCTGTGTGTGGCCATCAGCAGG + Intronic
905888138 1:41502705-41502727 TCCTCTCTGGGCTCAGAACCTGG - Intergenic
907998533 1:59657314-59657336 TCCTCTCTCTGGTCATCAATGGG - Intronic
912446553 1:109740732-109740754 TGCTCTGTGTGGTCAGAGGCTGG - Intronic
913073960 1:115325465-115325487 TCATTTCTGTGGTCATAAAGGGG - Intronic
915054540 1:153114058-153114080 TCCTCCCTGTGATTATAAGCAGG + Intergenic
918358332 1:183728091-183728113 TCCTCTCTCTGTTTTTAAGCTGG + Intronic
919939050 1:202273917-202273939 TCTTCCGTGTGGTCCTAAGCAGG + Intronic
920291214 1:204924358-204924380 TCCTGTCTGATGTGATAAGCGGG - Intronic
922992471 1:229926127-229926149 TCCTCTGAGTTTTCATAAGCTGG - Intergenic
923133429 1:231096901-231096923 AGCTCTCTGAGGTCACAAGCAGG - Intergenic
1064106369 10:12503930-12503952 TCCTCTCTGAGGGCCTCAGCTGG + Intronic
1064362078 10:14675211-14675233 TCCTCTCCATGGGAATAAGCTGG + Intronic
1065683504 10:28261468-28261490 TCCTAAATGTGGTCATAAGTGGG + Intronic
1069174258 10:65270884-65270906 TCCTGTCTGTGGGCACTAGCAGG + Intergenic
1070640163 10:78162660-78162682 TCCTCCCAGTGGACAGAAGCAGG + Intergenic
1070823258 10:79375561-79375583 TCCTCTCCCTGGTCACTAGCAGG - Intergenic
1071428261 10:85581304-85581326 TCCTCTGGGTGGTAATATGCTGG + Intergenic
1072524031 10:96255691-96255713 TCCTTTCAGTGTTCATAGGCTGG + Intronic
1074528035 10:114278339-114278361 TCCTCTGTGTGGTCCAAGGCAGG - Intronic
1074895224 10:117771613-117771635 AACTCTCTGTAGTCATAGGCAGG + Intergenic
1075287409 10:121198924-121198946 TCCTCACCCTGGCCATAAGCTGG - Intergenic
1076286218 10:129299697-129299719 TCATGTCTGTGCTCATAGGCCGG - Intergenic
1077716531 11:4586900-4586922 TCCATTGTGTGGTTATAAGCTGG - Exonic
1083841538 11:65307676-65307698 TGCTCTCTGATGTCATATGCTGG + Intergenic
1085470551 11:76754681-76754703 TCCTCTTTGTGCACATATGCAGG + Intergenic
1087180049 11:95133052-95133074 TCCTCTCTGTGGCCTTTAGTAGG + Intergenic
1087812250 11:102621055-102621077 TTCTCTCTCTGGGCACAAGCCGG + Intronic
1089211725 11:116808561-116808583 TCCTCTCTTTGCTCCCAAGCAGG - Intergenic
1089527457 11:119106887-119106909 TTCTCTCTGTTGACATCAGCTGG + Intronic
1091417021 12:296727-296749 CCCTCTATGTGGTCATTATCAGG - Intronic
1095148086 12:38755255-38755277 TACTCTCTCTGTTCACAAGCGGG + Intronic
1096483054 12:51955739-51955761 TCCTCTCTGTATTCATAAAAAGG + Intronic
1097974235 12:65667460-65667482 ACCCCTCTGAGTTCATAAGCTGG + Intergenic
1100037251 12:90267514-90267536 TCCTGTTTGTGCTCATAATCAGG + Intergenic
1100121721 12:91376098-91376120 TCCTCTGTGTGCTCATATTCTGG - Intergenic
1101658735 12:106747571-106747593 TCCTCTCTGTGGGGATAAACTGG - Exonic
1104048955 12:125183888-125183910 TCCTCTCTGAGCTCATACGTGGG - Intergenic
1105812458 13:24007350-24007372 TCATGTCTGTGGTCAGTAGCTGG + Intronic
1112991781 13:105522626-105522648 TCCTTGCTGTGGTCATACACAGG + Intergenic
1113694011 13:112331192-112331214 TGCCCTCTGTGGCCATGAGCGGG + Intergenic
1116008785 14:39326043-39326065 TCTTTTCTGTGGTCGTAAGAAGG + Intronic
1117720301 14:58622887-58622909 CCCCCTCTGTGGTCTTGAGCAGG - Intergenic
1123662486 15:22576357-22576379 TCTTCTCTGAGTTCATTAGCTGG + Intergenic
1123786940 15:23683856-23683878 TCCTCTCTGCTGTCAGAGGCAGG - Intergenic
1124261803 15:28199547-28199569 TCTTCTCTGAGTTCATTAGCTGG - Intronic
1124316286 15:28670641-28670663 TCTTCTCTGAGTTCATTAGCTGG + Intergenic
1125828359 15:42694119-42694141 TCCTGGCTGTGGTCATTAGGAGG - Exonic
1134243943 16:12525927-12525949 TCCACTCTGTTGTCATAACCTGG + Intronic
1137596432 16:49727250-49727272 ACCTCTCTGTTGTCCTCAGCAGG - Intronic
1137876749 16:52004231-52004253 CCCTCTTTGTGCTCTTAAGCTGG - Intergenic
1141911866 16:87065899-87065921 TCCTCTCTTTGATCAAAAGCCGG + Intergenic
1141986454 16:87583639-87583661 TCCTCTCTTGGGTCAGAGGCTGG + Intergenic
1142416834 16:89947899-89947921 TCCTCCCTGCGGGCACAAGCGGG + Intergenic
1144776884 17:17789248-17789270 TCTGCTCTGGGGTCCTAAGCAGG + Intronic
1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG + Intronic
1147743996 17:42684024-42684046 TCCTTTCTATAGGCATAAGCGGG + Exonic
1148430645 17:47640711-47640733 TCCTTTCTGTGGTAATGTGCTGG - Intergenic
1148845455 17:50527302-50527324 TCCTCTCTGTGGTTCTCATCAGG - Exonic
1150681421 17:67287653-67287675 CCCTCGCTGTGGTCAAAAGATGG + Intergenic
1150944537 17:69730692-69730714 TCCTCTCTGTGGGCCTTTGCAGG + Intergenic
1151367721 17:73628201-73628223 TCCTCTCTGTGCTCCTGAGGAGG - Intronic
1152789550 17:82271748-82271770 TCCTCTCTCTGGTGACAAGTGGG + Intronic
1155084053 18:22439151-22439173 TTGTATCTGTAGTCATAAGCAGG - Intergenic
1157181784 18:45504813-45504835 TCCTTTCTGTGGACATTAGTTGG + Intronic
1159747590 18:72257091-72257113 TCCTCTCTGTCTTCTTGAGCTGG - Intergenic
1162191670 19:8951839-8951861 TCCTGTCTGTGGTTATCACCAGG + Exonic
1162290574 19:9776985-9777007 TCTTCTCTGTGGTCATCAAATGG + Intronic
1166331283 19:42079414-42079436 TCGTAACTGTGGTCAGAAGCTGG - Exonic
1166958845 19:46485663-46485685 TCCTATCTGTGGGCATTTGCAGG + Intronic
925096246 2:1206380-1206402 TGCTCTCTGCAGTCACAAGCTGG - Intronic
925292602 2:2757606-2757628 TCCTCTCTGTGGACAAAACAGGG + Intergenic
925563198 2:5220656-5220678 TCCTTGCTGTGATCATGAGCCGG - Intergenic
925909545 2:8564563-8564585 TTCTCTCTGTTCTCAGAAGCAGG + Intergenic
926249583 2:11146734-11146756 TCCACTCTGAGATCATCAGCTGG + Intronic
927422791 2:22950460-22950482 TCATCCCTGAGGTCATCAGCAGG - Intergenic
929750628 2:44709107-44709129 TCCTCTCTGATTTCAAAAGCTGG - Intronic
935276249 2:101477340-101477362 CAGTCTCTGTGGACATAAGCAGG - Intergenic
935307619 2:101752718-101752740 ACCTGTCTGTGGTCATAAATTGG + Intronic
937152122 2:119693133-119693155 TCCTCACTGTGGACACAACCTGG - Intergenic
938608341 2:132920286-132920308 TCCTCTCTGAGGTCCTAGGTAGG + Intronic
940560777 2:155293055-155293077 TCCTCTTTGTACTCATAAGTGGG + Intergenic
946459198 2:219854131-219854153 TCCTCTCTGGAGTCAGAAACGGG + Intergenic
946610421 2:221452077-221452099 TTCTCTCTGAGGTCATCAGAAGG + Intronic
947892478 2:233637010-233637032 TCCCCTCTGTGGTCTTCACCAGG + Exonic
948276859 2:236715558-236715580 TCCTCTGTGTGGTCCTCATCTGG - Intergenic
949055278 2:241924825-241924847 TCCTTTCTGTGGTCATTCTCAGG + Intergenic
1171454215 20:25258308-25258330 TCCTTTCTGTGCTCCTCAGCAGG + Intronic
1171967152 20:31539256-31539278 ACATCTCTGTAGTCACAAGCTGG - Intronic
1175768729 20:61609264-61609286 TCTTCTCTGTGGTCATTTTCTGG - Intronic
1179175989 21:39008699-39008721 TCCTCTCTGAGGTGACAAGGTGG - Intergenic
1179776346 21:43665945-43665967 TCCTCTCTTTGGGTTTAAGCTGG - Intronic
1180980204 22:19874810-19874832 TCCTCTGTGTGCTGACAAGCAGG + Intergenic
1182728078 22:32464760-32464782 TCCTGTCTGGAATCATAAGCTGG + Intergenic
1183484545 22:38082102-38082124 TCCTCTCTGTGTCCCTGAGCCGG - Intronic
951356431 3:21672481-21672503 TCCTCTCTGTGGTCATAAGCAGG - Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
954843435 3:53533479-53533501 TCTTCTGTGTGGTCAGAATCAGG + Intronic
957502767 3:81078129-81078151 TCTTCTTGTTGGTCATAAGCTGG + Intergenic
960823911 3:121762447-121762469 TCCCTTCTGGGGTCAAAAGCGGG - Intergenic
965465538 3:169025754-169025776 TCCTCCCTGGGATAATAAGCTGG + Intergenic
965607484 3:170511433-170511455 TGCTCTCTGTGGTCTGGAGCAGG + Intronic
967428596 3:189355664-189355686 TGGTCTCTGTGCTCTTAAGCTGG + Intergenic
967601699 3:191398075-191398097 TCCTCAATGAGGTCATGAGCAGG - Intronic
967841957 3:194012734-194012756 TGCTCTGTGTGGTGGTAAGCTGG - Intergenic
968940778 4:3636444-3636466 TCTTCTGTGTGCTCATGAGCTGG - Intergenic
969258400 4:6018713-6018735 TCCTCTCTGTGTTCATCACTAGG - Intergenic
969433928 4:7173132-7173154 CCGACTCTGTGGTCATGAGCTGG + Intergenic
971148401 4:24005026-24005048 TCATCTCTGTTTTTATAAGCAGG - Intergenic
971545281 4:27878740-27878762 TTCTCTCTGTTGTCATTGGCTGG - Intergenic
972280082 4:37593561-37593583 TACTCTCTTTGGTCAAAATCTGG + Intronic
984984100 4:185310754-185310776 TCCTCTTGCTGGTCATAGGCAGG - Exonic
986426139 5:7633642-7633664 TCTTCACTGTGGACATGAGCAGG - Intronic
986999691 5:13647557-13647579 TCCCCACTGTGGTCAAAAGAAGG - Intergenic
991974205 5:72170537-72170559 TCCTCTCGGTGGGCAGAAGGAGG - Intronic
994314731 5:98319431-98319453 TCCCCTCTGTGGTAATCACCAGG + Intergenic
998726480 5:145022306-145022328 TCATCTTTGTGATCATAATCAGG - Intergenic
1002073457 5:176694443-176694465 TCCACTCTGTGGTCACCAGCTGG + Intergenic
1003105411 6:3211390-3211412 TCCTCTGCGTGGTCATTAGTGGG + Intergenic
1003614879 6:7645968-7645990 CTCTCTCTGTGGTCATAAGATGG - Intergenic
1006392796 6:33768694-33768716 TCCCCTCTGTGGTCAGAACAAGG + Intergenic
1010520878 6:76835094-76835116 TTCTCTTTGTGGTCATAAGGTGG + Intergenic
1014270028 6:119326246-119326268 TTCTCTCTCTGGACATAAGCAGG + Intronic
1014630869 6:123788435-123788457 CTCTCTCTGTGAACATAAGCTGG - Intergenic
1017344612 6:153366759-153366781 TCCTCTCAATGGTCATAATTAGG - Intergenic
1018634934 6:165852772-165852794 TTCTCTCTGTGCACATGAGCTGG + Intronic
1020642277 7:10770155-10770177 TCTTTTCTTTGGTCATTAGCAGG - Intergenic
1021694387 7:23262017-23262039 TCCTCTCACTGGTCACAAGAGGG + Intronic
1022944213 7:35266020-35266042 TTCTCTCTGGGGTCACAAGATGG + Intergenic
1023280072 7:38560252-38560274 TCCTCTCTGTGGACAAACCCAGG + Intronic
1024227327 7:47335903-47335925 TTCTCTCTCTGGTCAAATGCTGG - Intronic
1026134627 7:67648926-67648948 TTCTCTGTGTGGTCCTAACCCGG + Intergenic
1027780773 7:82517304-82517326 TCCTCTCTTTGTCCATAATCTGG - Intergenic
1029669997 7:102023303-102023325 CCTTCTTTGTGGTCATAAACTGG - Intronic
1031719437 7:125152950-125152972 TCCTCTCTTTGGTCATGTGATGG + Intergenic
1036642898 8:10595151-10595173 TCAGCTCTTTGGTAATAAGCTGG - Intergenic
1037720907 8:21443062-21443084 TTCTCTCTGTGGTCACCAGATGG - Intergenic
1039262598 8:35788288-35788310 TCGTCTTTGTGACCATAAGCTGG + Intronic
1040061032 8:43102932-43102954 TCCTGTCCGTGGTCATAACCAGG + Intronic
1041280925 8:56210957-56210979 TTCTCTCTGGGGTCCTGAGCAGG + Intronic
1041991743 8:64001104-64001126 TTCTCTCTTTGGGCACAAGCTGG - Intergenic
1048056437 8:130870518-130870540 TCTTTTCTCTGGTCCTAAGCAGG + Intronic
1053607154 9:39672153-39672175 TCCTCCCTGTGGTAATGAGTGGG - Intergenic
1053865062 9:42428820-42428842 TCCTCCCTGTGGTAATGAGTGGG - Intergenic
1054246380 9:62670255-62670277 TCCTCCCTGTGGTAATGAGTGGG + Intergenic
1054560501 9:66704789-66704811 TCCTCCCTGTGGTAATGAGTGGG + Intergenic
1056800176 9:89685678-89685700 TCCTCTCTGTGGGTACACGCTGG - Intergenic
1057000599 9:91505196-91505218 TCCTGTCTGTCCTCATCAGCAGG - Intergenic
1057306835 9:93917189-93917211 TCCTCTCAGTGGTCAGAGGAAGG - Intergenic
1058648059 9:107149050-107149072 TTCTGTTTGTGGTGATAAGCTGG + Intergenic
1059959305 9:119549870-119549892 TCTTCTCTGGGTTCATAAGATGG - Intergenic
1059982622 9:119789841-119789863 TCCTCCCTGTGGTGATGACCTGG - Intergenic
1062088876 9:134663647-134663669 TCTTCTCTGTATTCATAATCTGG - Intronic
1062200888 9:135302073-135302095 TCCTCTCTGGGGGCAGAGGCAGG + Intergenic
1186130992 X:6465132-6465154 ATCACTCTGTGGTCATAGGCTGG + Intergenic
1186686593 X:11931053-11931075 TCCTCTCTTTAGTCATGAACTGG - Intergenic
1190535390 X:51421337-51421359 TCCTCTCTGTTGGGATTAGCAGG + Intergenic
1193069722 X:77295129-77295151 TCCAGTCTTAGGTCATAAGCGGG - Intergenic
1193591430 X:83392803-83392825 TCCTCTCTGTTGGGATTAGCAGG + Intergenic
1196740187 X:119017811-119017833 TTCTCTCTGTGATCAACAGCAGG - Exonic
1200842170 Y:7793652-7793674 TCTTCTGTGTGATCAGAAGCGGG - Intergenic