ID: 951356825

View in Genome Browser
Species Human (GRCh38)
Location 3:21677358-21677380
Sequence AAATATACAAATCTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 460}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951356821_951356825 -2 Left 951356821 3:21677337-21677359 CCCTCTTGTGAATTGCAGCCTAA 0: 1
1: 0
2: 3
3: 11
4: 170
Right 951356825 3:21677358-21677380 AAATATACAAATCTGGAGCTTGG 0: 1
1: 0
2: 3
3: 35
4: 460
951356822_951356825 -3 Left 951356822 3:21677338-21677360 CCTCTTGTGAATTGCAGCCTAAA 0: 1
1: 0
2: 2
3: 5
4: 130
Right 951356825 3:21677358-21677380 AAATATACAAATCTGGAGCTTGG 0: 1
1: 0
2: 3
3: 35
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951356825 Original CRISPR AAATATACAAATCTGGAGCT TGG Intronic
901300058 1:8193442-8193464 AAAAAAAAAAATCTGGAGCCTGG + Intergenic
902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG + Intronic
902605603 1:17567525-17567547 AAAAATACAAAAAAGGAGCTGGG - Intronic
902684199 1:18065176-18065198 AAATCTGCAAGTCTGCAGCTTGG + Intergenic
903114105 1:21164067-21164089 AAAGAAACAAAATTGGAGCTGGG - Intronic
904117221 1:28171765-28171787 TAATATACATATCTGGGGCCAGG - Intronic
904657711 1:32061887-32061909 AAATATGCAAATGATGAGCTGGG - Intergenic
904696354 1:32333922-32333944 AAAAGTACAAATCTGGGGTTTGG + Exonic
904899421 1:33844937-33844959 AATTTTACAAATCTGCAGCAGGG - Intronic
905162411 1:36047925-36047947 AAATATAGACATCTAGATCTAGG + Intronic
906449796 1:45935471-45935493 AAATATACCACTCTGGACATAGG - Intronic
906976712 1:50582183-50582205 AAGAATACAAATATGTAGCTTGG + Intronic
907886722 1:58598744-58598766 AAAAGTACAAATCTGGTTCTGGG - Intergenic
908662009 1:66446907-66446929 AAATGTCCACATCAGGAGCTTGG - Intergenic
908840223 1:68272824-68272846 AAAAATACAAATTTGAAGCAGGG + Intergenic
908984552 1:70001103-70001125 AACTATACAATTCTGGAGCTGGG - Intronic
910448600 1:87325004-87325026 AAAAATACAAAACTTTAGCTGGG - Intergenic
910537115 1:88310916-88310938 ATATATATAAGTCTGGAGTTTGG - Intergenic
911044085 1:93614550-93614572 AAATAAACAGCTCTGGAGGTGGG - Intronic
911113253 1:94214431-94214453 AGAAATGCGAATCTGGAGCTTGG - Intronic
911943079 1:104072119-104072141 AAATCTAGAAAACTGGGGCTGGG - Intergenic
912810017 1:112786999-112787021 AAAAATACAAAATTAGAGCTCGG + Intergenic
912948626 1:114105410-114105432 AAAAAGACAAATCTAGGGCTAGG - Intronic
913457314 1:119046649-119046671 AAACAAACAAATTTGGGGCTGGG - Intronic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
916243619 1:162664259-162664281 ATACATACAATTCTGGAGTTAGG - Intronic
916541285 1:165757393-165757415 AAATGTACAAATCTAGAGAATGG + Intronic
917315777 1:173723810-173723832 AAATATAACGATCTGGAGCATGG + Intronic
917550978 1:176028659-176028681 AAAAAAAGCAATCTGGAGCTAGG + Intronic
917604788 1:176615884-176615906 AAACATACAAGTATGGTGCTGGG + Intronic
917831037 1:178886583-178886605 GAATATGTGAATCTGGAGCTCGG + Intronic
918526616 1:185471748-185471770 AGATATATGAATTTGGAGCTCGG + Intergenic
918565666 1:185928141-185928163 CAATATACAAATTTGAAGGTAGG - Intronic
918795541 1:188889860-188889882 AACTTTACAAATCTGGAGAAAGG + Intergenic
918813027 1:189145159-189145181 AAATTGACAAAACTTGAGCTAGG + Intergenic
918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG + Intergenic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
920748782 1:208654394-208654416 CAATTTACAAATCTGGCACTAGG + Intergenic
920751532 1:208682503-208682525 AAATGTACAATTCTTGTGCTGGG - Intergenic
921537198 1:216366348-216366370 AAATATACCACTCTGGTGCAGGG + Intronic
922170695 1:223152002-223152024 TAATCCACAAATCTGGAGGTGGG + Intergenic
922731749 1:227952160-227952182 ATAATTACACATCTGGAGCTGGG - Intergenic
923514102 1:234680260-234680282 AAATATACCACTCTGGAGTGTGG + Intergenic
923599971 1:235394233-235394255 AAATATACAAAAAAGTAGCTGGG - Intronic
924092575 1:240516695-240516717 AATAATACAAATCAGGAGGTAGG - Intronic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
1063027924 10:2201359-2201381 AAATACACAAATCAGCTGCTTGG - Intergenic
1063838073 10:10039199-10039221 AAATATATATATTAGGAGCTGGG - Intergenic
1064077734 10:12283241-12283263 AATTTTAAAAATCTGGAACTAGG - Intergenic
1064712908 10:18144552-18144574 GAACAGACAGATCTGGAGCTTGG - Intronic
1064998215 10:21314985-21315007 ATATATACGAATCAGGGGCTGGG - Intergenic
1065785157 10:29206054-29206076 AAATAAACAACTTTGTAGCTGGG + Intergenic
1066019985 10:31288785-31288807 GAATATACAGATGTGAAGCTCGG + Intergenic
1066214727 10:33275055-33275077 AAATATACAATGGTGGAGCTAGG + Intronic
1067824771 10:49562832-49562854 AAAAATACAAAACTTTAGCTGGG + Intergenic
1068763861 10:60741534-60741556 AAAGATACTCATATGGAGCTGGG + Intergenic
1068908088 10:62349438-62349460 AAATATACAAATATATAGATGGG - Intergenic
1069593384 10:69655485-69655507 AAAGATACAAATTTAGAGCCTGG + Intergenic
1071275330 10:84048983-84049005 AAAAAAAAAAATCTGGAGGTGGG + Intergenic
1072476864 10:95770010-95770032 GGATATACAAATTTGGAGTTTGG + Intronic
1072641244 10:97212831-97212853 AAATATAAAAATTAGCAGCTGGG + Intronic
1074014580 10:109521168-109521190 AAATGTACAAATATGGTGGTAGG - Intergenic
1074563153 10:114552355-114552377 AAATATAGAAAGCTGGTGATTGG + Intronic
1075205350 10:120443116-120443138 AAATCTACAAATGTGGAGTAGGG + Intergenic
1075646140 10:124097893-124097915 GAATATACAAGTCTGGACATTGG - Intergenic
1075647073 10:124103653-124103675 AAACATGCAAATCTGGAGCAAGG - Intergenic
1076844893 10:133065288-133065310 AAACATACAGAGCTGCAGCTGGG - Intergenic
1079733333 11:23962850-23962872 ACATATGCAGATGTGGAGCTGGG - Intergenic
1080045214 11:27800870-27800892 AAACATAAAAATGTGGGGCTCGG - Intergenic
1080694994 11:34595821-34595843 AAATAGAAAAATCTGGGGATGGG - Intergenic
1080831743 11:35900450-35900472 AAAAATAGAAAAATGGAGCTGGG + Intergenic
1081279969 11:41197278-41197300 AAATAGAAAAATCTGAATCTGGG - Intronic
1081346338 11:41991679-41991701 AAATATACAAATCCAGATGTGGG - Intergenic
1081952971 11:47061749-47061771 AAATAAACAAAACGGGAGCTAGG - Intronic
1082717918 11:56638269-56638291 AAATACATGAATCTGGAACTTGG + Intergenic
1083070668 11:59977224-59977246 AACTATAGAAATCTTGGGCTGGG - Intergenic
1084338613 11:68476848-68476870 AAATATATATATGTAGAGCTGGG - Intronic
1084375093 11:68771269-68771291 AAATGTACTAAACTGGAGCGTGG + Intronic
1084472939 11:69373800-69373822 AAATATACAAAAAAGTAGCTGGG + Intergenic
1084929775 11:72545730-72545752 AAATATACGAAGAAGGAGCTGGG - Intergenic
1084969613 11:72763895-72763917 AAAAATAGAAAACTGAAGCTTGG + Intronic
1085745965 11:79114509-79114531 CAAAATATAAATCTGGAGCCTGG + Intronic
1086397853 11:86434359-86434381 AAATATACAAATTTTGTGCTGGG - Intergenic
1086776035 11:90833907-90833929 AAAAATACAGTTCTGGAGCCTGG - Intergenic
1088148417 11:106713799-106713821 AAATATACTAATGTTGGGCTGGG - Intronic
1088962545 11:114684092-114684114 GAATATATAGATCTGAAGCTGGG + Intronic
1088996415 11:115002313-115002335 AAATTTACAAACCTTTAGCTCGG + Intergenic
1089222209 11:116882770-116882792 AAATATAGAACTCTTGGGCTGGG - Intronic
1089415818 11:118289547-118289569 ATATGTCCAAATTTGGAGCTTGG + Intergenic
1089431416 11:118427799-118427821 AAAAATACAGATCTGGGACTTGG - Intronic
1089591364 11:119543134-119543156 AAATAGACCACTCTGGTGCTGGG - Intergenic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1090552338 11:127836434-127836456 AAATATACAAATATGGAAGGTGG + Intergenic
1092248107 12:6874657-6874679 AACTACAGAAATCTGGGGCTGGG - Intronic
1093819107 12:23590211-23590233 AAGTATACATTTCTGGAACTGGG + Intronic
1094139335 12:27164580-27164602 AAATGTGCAAATCTGGAAATAGG + Intergenic
1094189856 12:27687199-27687221 AAAAATACTAATCTGGGGTTTGG + Intronic
1096448612 12:51718039-51718061 AAATATACCAATCTGGGGACAGG + Intronic
1097088246 12:56485558-56485580 AAATATATAAATTTAGAGCCAGG - Intronic
1099430727 12:82582014-82582036 AAATTGACAAATCTTTAGCTAGG + Intergenic
1100190336 12:92184115-92184137 AAATATACAATTCTGGAAAAGGG - Intergenic
1100193649 12:92219725-92219747 ATTTTTACAAAACTGGAGCTGGG - Intergenic
1100233925 12:92638206-92638228 AAATATACAAAAATATAGCTAGG + Intergenic
1100537431 12:95524239-95524261 AAAAATACAAAACTGTAGCCGGG - Intronic
1100588733 12:96004316-96004338 AAATATACAAAGATAAAGCTAGG - Intronic
1100610420 12:96187255-96187277 AAATTTAAAACTCTGAAGCTTGG + Intergenic
1101826122 12:108221393-108221415 AAAAATACAAAAATTGAGCTGGG + Intronic
1103296851 12:119894984-119895006 AAGTATACAAACCTGAAGCTAGG + Intergenic
1105035820 12:132920131-132920153 AAATAAATAAATCAGGCGCTGGG - Intronic
1105241904 13:18615536-18615558 AATTACAAAAAACTGGAGCTAGG - Intergenic
1108262959 13:48676781-48676803 AAAGAAACAAATCTGGGACTAGG - Intronic
1108484844 13:50913027-50913049 AGATAAACAAATCTGGAACTTGG + Intronic
1108722024 13:53141959-53141981 AAAAATATCGATCTGGAGCTTGG - Intergenic
1110987969 13:81997248-81997270 ATAAAGACAAATCTGAAGCTGGG - Intergenic
1111160555 13:84389531-84389553 ATATACACAAATCAGTAGCTTGG - Intergenic
1111367236 13:87264725-87264747 AAATAGAAGAATCTAGAGCTGGG - Intergenic
1111483751 13:88867749-88867771 AAAAATACAAACGTTGAGCTGGG + Intergenic
1112124261 13:96447343-96447365 AAATATAAAGATCTGGAGAGAGG - Intronic
1112684185 13:101803889-101803911 TAATATACAAGTTTGGAGCTCGG + Intronic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1114180487 14:20363084-20363106 AAATTTATACATCTGGAGGTAGG - Intergenic
1115160502 14:30388430-30388452 AAATAATCAAATCTGGTTCTTGG - Intergenic
1116757855 14:48970282-48970304 GAATTTACAACTCTGGAGTTTGG - Intergenic
1117067996 14:52029815-52029837 AATTATCCATATCTGAAGCTAGG + Intronic
1117208171 14:53466510-53466532 AAATCAACAAATCTTTAGCTAGG - Intergenic
1118008701 14:61588537-61588559 AAACAAGCAAGTCTGGAGCTCGG - Intronic
1118403652 14:65402371-65402393 AAAAAAAAAAATCTGGGGCTGGG + Intergenic
1118612191 14:67550084-67550106 AAATACACAAATACGGAGCTGGG - Intronic
1119045607 14:71315948-71315970 GGATGTACAAATCTGGAGATGGG + Intergenic
1119067312 14:71542064-71542086 AAATATAGAAATAAGGAGTTGGG - Intronic
1119300908 14:73570406-73570428 AAAAATACAAAACAGTAGCTGGG + Intronic
1119371672 14:74150893-74150915 ATATTTTGAAATCTGGAGCTTGG - Intronic
1120163666 14:81171362-81171384 AAATATACAAATCTTCAGAGAGG + Intergenic
1120322247 14:82978814-82978836 AAATATTAGAATCTGGAGCAGGG + Intergenic
1120988126 14:90351902-90351924 AAATACAAACATATGGAGCTGGG + Intergenic
1120989873 14:90365863-90365885 AAATAAATAAATCTGAAACTGGG - Intergenic
1121089420 14:91170846-91170868 AAATAAAGAAACCTGGAGCCTGG - Intronic
1121808847 14:96859890-96859912 GGATATACAAGTCTGGAGGTCGG + Intronic
1122073520 14:99221009-99221031 AAATATAAAAAAATGTAGCTGGG - Intronic
1122728771 14:103779464-103779486 AAAAATAAAAATTTGGGGCTGGG + Intronic
1123484763 15:20680305-20680327 AAAAATACAAAACTTTAGCTAGG + Intergenic
1123537491 15:21249371-21249393 AAAAATACAAAACTTTAGCTAGG + Intergenic
1125242909 15:37597252-37597274 GAATCTACAAATCTAGAGCAGGG - Intergenic
1125789674 15:42354755-42354777 AAAAATACAATTCTGGAGTTTGG + Exonic
1126357112 15:47808273-47808295 AAATATTCAAATATAGAGCCGGG - Intergenic
1126414364 15:48402771-48402793 AAATATACAAATCAGAAACAGGG - Intergenic
1126427556 15:48545862-48545884 AAATACACAAAAATGTAGCTGGG + Intronic
1126883809 15:53128445-53128467 AAATAGACAAATATTTAGCTAGG + Intergenic
1127672999 15:61213351-61213373 AAATATACTTATGTGGAGTTAGG - Intronic
1127683816 15:61322403-61322425 AAAAATACAAATCTTGGGGTGGG + Intergenic
1127697383 15:61463707-61463729 GTATATACAAGTCTGGAACTTGG - Intergenic
1127938394 15:63666718-63666740 AGATTTACAAATATGGAACTTGG - Intronic
1128775288 15:70315773-70315795 AAATAAAGATATCTGGGGCTGGG + Intergenic
1129043316 15:72709695-72709717 AAATAGGAAACTCTGGAGCTAGG - Exonic
1129195656 15:73964731-73964753 AAATATAAAAACCTAGGGCTGGG - Intergenic
1129426964 15:75470449-75470471 AATTTTAGAAATCTGGGGCTGGG - Intronic
1130730623 15:86488403-86488425 AGATTTACAAGACTGGAGCTGGG - Intronic
1131109345 15:89755142-89755164 AAAAATAAAAATGTTGAGCTAGG - Intergenic
1132084284 15:98894233-98894255 AAATAGAAAAATCTGAAGCTGGG - Intronic
1132548147 16:543056-543078 AAAAATACAAACCCTGAGCTTGG + Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133411078 16:5569291-5569313 AAAAAGACAAATTTGAAGCTTGG + Intergenic
1133562613 16:6963991-6964013 AAATAAATAAATCCGGGGCTGGG - Intronic
1134831096 16:17323611-17323633 ACATGTACAAGTCCGGAGCTGGG - Intronic
1135024479 16:18988584-18988606 AAATATACAAAAATTGGGCTGGG - Intronic
1135315571 16:21441897-21441919 AAATATACAAAAATTGGGCTGGG + Intronic
1135368497 16:21874160-21874182 AAATATACAAAAATTGGGCTGGG + Intronic
1135443320 16:22496984-22497006 AAATATACAAAAATTGGGCTGGG - Intronic
1135449102 16:22542368-22542390 AAATATACAAAAATTGGGCTGGG - Intergenic
1135459149 16:22626628-22626650 AGATGTTCAAATCTAGAGCTTGG - Intergenic
1136252488 16:29014993-29015015 AAAAATACACTTCTGGAGCCTGG - Intergenic
1136312256 16:29420641-29420663 AAATATACAAAAATTGGGCTGGG + Intergenic
1136325682 16:29522360-29522382 AAATATACAAAAATTGGGCTGGG + Intergenic
1136440371 16:30262342-30262364 AAATATACAAAAATTGGGCTGGG + Intergenic
1137827551 16:51512228-51512250 AAAACTACACATCTGGAACTAGG + Intergenic
1138671725 16:58621119-58621141 AAAAATACAAAACTTGAGGTGGG - Intronic
1138764752 16:59588703-59588725 AAATATGCAAACCTGGAAATAGG + Intergenic
1139213744 16:65107256-65107278 AAATATGCAAATCAAGACCTAGG - Intronic
1139835452 16:69834685-69834707 AAAAATACAAAACATGAGCTGGG - Intronic
1139886880 16:70214689-70214711 AAATATACAAAAATTGGGCTGGG + Intergenic
1140419204 16:74804086-74804108 AAATGGACAAATCTTTAGCTAGG - Intergenic
1141780866 16:86159866-86159888 AAATATCCATAGCTTGAGCTAGG - Intergenic
1142163787 16:88574032-88574054 AAATATACAAAACATTAGCTGGG - Intronic
1142624699 17:1184292-1184314 AAATATACAAAACATTAGCTGGG + Intronic
1142719851 17:1768770-1768792 AAATATAAAAATTGGGAGCCAGG - Intronic
1143418167 17:6765509-6765531 TAATATACAAATCTAGAGTTTGG - Intronic
1143753926 17:9052615-9052637 AAAAATATAAGTCTAGAGCTGGG + Intronic
1143986619 17:10920038-10920060 AACTCTACAAATCTCGAGATTGG + Intergenic
1144119204 17:12133788-12133810 CCATATACAACTCTGTAGCTTGG + Intronic
1144190196 17:12838660-12838682 AAATAAACAAAATTGGAGATGGG - Intronic
1144885356 17:18454858-18454880 AAATACAAAAATCAGGGGCTGGG - Intergenic
1145146865 17:20489521-20489543 AAATACAAAAATCAGGGGCTGGG + Intergenic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1146031604 17:29371060-29371082 AAAGATACAAATTTGAGGCTGGG - Intergenic
1146146034 17:30417408-30417430 AAAAAGACAGGTCTGGAGCTTGG - Intronic
1146335830 17:31969445-31969467 AAATATAAAAATTAGGGGCTGGG - Intronic
1146822010 17:35990950-35990972 AAAAGTAAAAATCTTGAGCTGGG - Intronic
1147430544 17:40367796-40367818 AAAAAAAAAAATCTGGGGCTGGG + Intergenic
1147490851 17:40864715-40864737 AAATTTAGAAATCTGGAGTCAGG - Intronic
1148709253 17:49665317-49665339 AAATATACCAATTTGGGGCCCGG + Intronic
1149149280 17:53540074-53540096 ATATTTACAAATCTGGAGGCTGG - Intergenic
1149936623 17:60813233-60813255 AAATATATAAATCTGAGGTTAGG - Intronic
1150195452 17:63293624-63293646 AAATATAAACAGCTGCAGCTAGG - Intronic
1150199401 17:63338770-63338792 ACATATACAAAACTGAAGATAGG - Intronic
1151955574 17:77378554-77378576 AAATATGCAGATCTGGGGATGGG + Intronic
1152982285 18:289829-289851 AAAAAAAAAAAACTGGAGCTAGG + Intergenic
1154447047 18:14444341-14444363 AATTACAAAAAACTGGAGCTAGG + Intergenic
1157519632 18:48336734-48336756 AAATATCCAATCCTGGAGGTAGG - Intronic
1157918707 18:51694646-51694668 AAATGAGCAAATCTGGGGCTGGG + Intergenic
1158020098 18:52831768-52831790 TAATATACAAATGTGGATTTAGG + Intronic
1159439056 18:68454651-68454673 AAACAAACAAGACTGGAGCTGGG + Intergenic
1159566889 18:70061359-70061381 AAATATCCAATTTTAGAGCTTGG - Intronic
1160132986 18:76246195-76246217 ATAGATACAAATCTGGGACTTGG - Intergenic
1160985972 19:1838957-1838979 AAATACAAAAATCAGCAGCTGGG + Intronic
1161699818 19:5788411-5788433 AAATACACACAAGTGGAGCTTGG + Intronic
1161729237 19:5948795-5948817 TAATAAACATATCTGAAGCTCGG + Intronic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1162502677 19:11063012-11063034 AAATACACAAATTAGGGGCTGGG - Intronic
1162598768 19:11650690-11650712 AAATTAACAAATTTGAAGCTGGG - Intergenic
1162640155 19:12002196-12002218 AAATAAACAAATTTGATGCTGGG - Intergenic
1162702524 19:12528199-12528221 GAATAAATAAATCTGAAGCTGGG + Intronic
1162821469 19:13225985-13226007 TAATATACAAATCGGGGGCTGGG - Intronic
1163521397 19:17794119-17794141 AAATCTACAAATCTGAGGCCAGG + Intergenic
1163741878 19:19019595-19019617 AAATATACAAAAATGTATCTAGG + Intronic
1165082125 19:33313769-33313791 AAATAAAAAAATCTGGAGGCTGG + Intergenic
1165383425 19:35496297-35496319 AAATATTCAAGTCAGGAGCAGGG - Intergenic
1165604697 19:37091764-37091786 AAAAATACAAAAATTGAGCTGGG + Intronic
1166037690 19:40181043-40181065 AAATATAAAAATCAGCAGCTGGG + Intergenic
1166281049 19:41793880-41793902 AAATATAGAAATATGGGGCCGGG + Intergenic
1167908729 19:52684072-52684094 AAAAATACAAAAATTGAGCTGGG + Intronic
1168358610 19:55718975-55718997 AAAGATACAGATGTGCAGCTGGG - Intronic
925201535 2:1970832-1970854 AAATATACAATTTGGGAACTTGG - Intronic
925682471 2:6437141-6437163 AAATGTGCAAATTTAGAGCTGGG + Intergenic
928169746 2:28995634-28995656 AAATCTACAAATCTAGAAATAGG + Intronic
928662832 2:33520854-33520876 AAATAAAAAAAACTGAAGCTTGG - Intronic
930446845 2:51484458-51484480 AAATACATAGATCTGGAGTTTGG + Intergenic
930539544 2:52688166-52688188 AAATACAAAAATCTGAAGATTGG - Intergenic
931728663 2:65133762-65133784 AAAAAAACAAAACTGGGGCTTGG + Intergenic
931898087 2:66756157-66756179 AAATAAACACTTCTGGAGCCAGG + Intergenic
932994452 2:76833095-76833117 TGAAATACAAATCTGGAACTTGG + Intronic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
933209702 2:79552432-79552454 AAATCTACAATTCTGGAGTCTGG + Intronic
933654463 2:84876179-84876201 GAATATGTAAGTCTGGAGCTTGG + Intronic
933757215 2:85649228-85649250 AAAAATACAAATCAGGAAATGGG - Exonic
934604570 2:95684325-95684347 AAAAATACAAAACTTTAGCTGGG - Intergenic
936464403 2:112734448-112734470 AAAGATAGAAATCTGGAGTTTGG - Intronic
936804547 2:116313138-116313160 AAATAGACAAATCTCAGGCTCGG - Intergenic
937620077 2:123975320-123975342 AAAAATACAAATTTCGGGCTAGG + Intergenic
939627656 2:144497700-144497722 AAAAATACCAATCTAGTGCTGGG + Intronic
941309360 2:163910220-163910242 ACATTTACAAACCTTGAGCTAGG - Intergenic
942287024 2:174429574-174429596 AAATGTACCATTCTGGTGCTGGG - Exonic
943196029 2:184751155-184751177 AAAAATTGAAATCTGGATCTTGG - Intronic
943485031 2:188468769-188468791 AAAAAAACAAATCTGGACTTAGG + Intronic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
944614835 2:201450119-201450141 AAAAATAGAAAACTGGAGCTGGG + Intronic
944754952 2:202751609-202751631 AAATATACAAAAATTTAGCTGGG + Intronic
945313698 2:208346743-208346765 AAATAACCAAACCTGGAGGTTGG + Intronic
945462515 2:210126517-210126539 AAAAACACAAATCTAGAGTTGGG + Intronic
946301178 2:218824896-218824918 AAACAGACAAATCTGGATGTGGG + Intronic
946344503 2:219097772-219097794 GAATATACAAGTCTGGGGTTTGG + Intronic
947495161 2:230630407-230630429 AAATATATAAATTTTGAGCCAGG - Intergenic
947617397 2:231567196-231567218 CAATATATAAATTTGGAGGTGGG - Intergenic
1169432553 20:5551623-5551645 AACTATACAAAACTACAGCTGGG + Intronic
1169434974 20:5578891-5578913 AAATAAATAAATCTAGGGCTGGG + Intronic
1170199047 20:13722676-13722698 AAAAAAAAAAATGTGGAGCTGGG - Intronic
1170211288 20:13848619-13848641 AAATACAAATATCTGGAGCCGGG + Intergenic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1174009360 20:47437149-47437171 AAAAATAAAAATATGGGGCTGGG + Intergenic
1176925961 21:14749056-14749078 GAATATATAAATCTAGAGCATGG + Intergenic
1176949257 21:15024746-15024768 AACAATACAGATCTAGAGCTTGG - Intronic
1177389509 21:20450044-20450066 AGATATAAAAAACTGGAGGTGGG - Intergenic
1178337622 21:31757898-31757920 AAATATATATATTTGGGGCTTGG - Intergenic
1179330063 21:40391317-40391339 ACATATAGAAATCTGGAGGGAGG + Intronic
1180246285 21:46549986-46550008 AGATAAACAAAGCTGGAGCCAGG - Intronic
1180250573 21:46584299-46584321 AAATTAACAAAACTGTAGCTAGG + Intergenic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
1181777643 22:25171004-25171026 CAATATAGAAATCAGGAGGTGGG - Intronic
1182061311 22:27400024-27400046 AGATATACTAATCTGTACCTTGG + Intergenic
1182435956 22:30329991-30330013 AAATAAAGAACTCTGGAGTTTGG - Intergenic
1183565545 22:38611801-38611823 AAATATACAAGACTGGACTTTGG - Intronic
1184868393 22:47217321-47217343 AAATATACATCTCAGTAGCTGGG + Intergenic
1185071156 22:48657097-48657119 AAATTGACAAATCTCTAGCTAGG + Intronic
1185268078 22:49915210-49915232 AAATATAAAAACCTGGGGCCGGG + Intronic
950791127 3:15473310-15473332 AAATATACAAAACATTAGCTGGG - Intronic
951034784 3:17921126-17921148 AATTATAAAAGTCTGGAGGTAGG + Intronic
951082278 3:18466649-18466671 AAATCTTCATTTCTGGAGCTTGG - Intergenic
951356825 3:21677358-21677380 AAATATACAAATCTGGAGCTTGG + Intronic
951440785 3:22721211-22721233 AAACATAAAACTCTGGACCTGGG + Intergenic
951711470 3:25588396-25588418 AAATATTCATATCTTGATCTAGG + Intronic
951862274 3:27266449-27266471 GAATATGTAAATCTGGTGCTCGG - Intronic
951864955 3:27298005-27298027 ACATAAGCAAAACTGGAGCTTGG + Intronic
952120296 3:30234082-30234104 AAACAAACAAATATAGAGCTTGG + Intergenic
953762044 3:45696156-45696178 AAAAATACAAAACAGTAGCTGGG - Intronic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
954818883 3:53307330-53307352 AAAATTACAAATCTGGGGCTTGG - Intronic
955005285 3:54963113-54963135 AAATAAATAAATCTGGAGGGTGG + Intronic
957261168 3:77903213-77903235 AAATTTACAAATCTGGATAAAGG + Intergenic
957588876 3:82169725-82169747 AAAGATACAAATTTGCAGTTAGG + Intergenic
957764361 3:84602642-84602664 AAATAAACAATACTGGAGCAAGG - Intergenic
957833921 3:85560851-85560873 ACATTTACATATTTGGAGCTGGG - Intronic
957893303 3:86387509-86387531 GGATATACAAATCTGGACCCTGG - Intergenic
959068373 3:101679908-101679930 AAATATATAAATCTCAGGCTGGG + Intergenic
959375020 3:105579082-105579104 AAAAAGAAAAATCTGGGGCTAGG + Intergenic
959552452 3:107678206-107678228 AAATATAAACAGCAGGAGCTTGG - Intronic
961900852 3:130210029-130210051 AAATAAACAAAAATAGAGCTGGG - Intergenic
962894498 3:139701858-139701880 ACATCTTTAAATCTGGAGCTGGG + Intergenic
963087333 3:141450440-141450462 AAAAATACAAAACTTTAGCTGGG + Intergenic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
964833173 3:160908929-160908951 AAAAATACAAATATGAAGGTGGG + Intronic
965843353 3:172932912-172932934 AAATATACAAAAATTGATCTTGG - Intronic
966674163 3:182567279-182567301 AAATATGCTACTCTGGAACTTGG - Intergenic
966674232 3:182568048-182568070 AAATATACAACACTGGAGGGGGG + Intergenic
967245861 3:187485762-187485784 AATTATACAACTTTGGAACTGGG - Intergenic
967674349 3:192278249-192278271 AAATATAGAAATCTGAAAATAGG + Intronic
967993913 3:195152572-195152594 AAATATAAAAATCTGGGGAGGGG + Intronic
969419510 4:7083866-7083888 AAAAATAGAAATCTGGGGCAGGG - Intergenic
969840174 4:9875786-9875808 AAATGTCCCAATCAGGAGCTTGG - Intronic
970778000 4:19700400-19700422 AAATACAAGAATATGGAGCTAGG + Intergenic
971938525 4:33185981-33186003 AAATGTAGAATTCTGGAGCCTGG - Intergenic
972161600 4:36234454-36234476 CAACATACAAATCGGGAGCGGGG + Intronic
972284985 4:37639477-37639499 AAATATCCAAATTTGTAGATGGG + Intronic
972520510 4:39850837-39850859 AAATAGACAAATCTGGAAATGGG + Intronic
974308247 4:60170527-60170549 AAATATACAATTCTGGTGGGAGG - Intergenic
974733853 4:65902506-65902528 AAAGAAACAAATATGGGGCTGGG - Intergenic
975233294 4:71960252-71960274 AATTATTGAAATCTGGAACTGGG + Intergenic
975567297 4:75771877-75771899 AAAAATTAAATTCTGGAGCTAGG + Intronic
975909783 4:79253301-79253323 GAATATAAAAATGTGGAGTTTGG + Intronic
976034881 4:80805546-80805568 AAATATAATAATCTTGGGCTGGG + Intronic
976093381 4:81480370-81480392 AAAGAGACAGATCTGGAGCTAGG + Intronic
977304599 4:95306852-95306874 AAATATACAAAGCTGCAGGTTGG + Intronic
977662830 4:99610460-99610482 AATTATAGAAATCTGGTCCTAGG - Intronic
977814832 4:101403054-101403076 ATAAATACAAAGCTGCAGCTAGG + Intergenic
978195191 4:105963371-105963393 ATATTTACAAATCTGGATCTTGG - Intronic
978724925 4:111958430-111958452 AGATATACAAATCTAGAGTCTGG - Intergenic
979234355 4:118383053-118383075 AAATAAATAAAACTGGACCTAGG - Intergenic
979879245 4:125933723-125933745 AAATTGACAAATCTGTAGCCAGG + Intergenic
981463790 4:145041933-145041955 AAATATACATATCTGAAACTGGG - Intronic
981473140 4:145160271-145160293 TAAAATTAAAATCTGGAGCTAGG - Intronic
981785301 4:148471467-148471489 AAATATTCAAATCTTGAGTCAGG + Intergenic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982025748 4:151252661-151252683 GAATATATAAATCTGGAATTTGG - Intronic
982102413 4:151980913-151980935 AACTCTACAAGTCTTGAGCTTGG - Intergenic
982979407 4:162113125-162113147 AGATATACCAATCTAGAGGTTGG - Intronic
983163852 4:164451108-164451130 ACATTTACAATTCTGGGGCTGGG + Intergenic
983241734 4:165241321-165241343 AAATATACAAAGCAGGAAATAGG - Intronic
983958841 4:173728019-173728041 AAAAAAACAAAACTGCAGCTAGG + Intergenic
984047335 4:174816405-174816427 AAATATACAGAACTGGAAATAGG - Intronic
984320515 4:178190079-178190101 AAATATATAAATTTGGAGCCAGG + Intergenic
986383248 5:7207388-7207410 CAATATCCAAAACTTGAGCTTGG - Intergenic
989749958 5:44881500-44881522 AAAGAAACAAATCACGAGCTAGG + Intergenic
990534569 5:56707529-56707551 AAAAATACAAATAAGCAGCTGGG - Intergenic
990755714 5:59066977-59066999 AAATAAATAAATCACGAGCTGGG - Intronic
991578267 5:68127347-68127369 CAATCTGCAAATCTGGAGCCAGG + Intergenic
991631213 5:68657971-68657993 AAGAATACAAATCTGTATCTGGG + Intergenic
992029360 5:72705530-72705552 AAAATCACAAATCTGGAGCCTGG - Intergenic
993161869 5:84301860-84301882 AAATATAAACATCTGAACCTAGG - Intronic
993216197 5:85025434-85025456 AAAAATACAAATATAAAGCTAGG - Intergenic
995547177 5:113244805-113244827 AAATATATAGATCTGGTGCTTGG - Intronic
995832352 5:116367142-116367164 AAATTTACAAAAAGGGAGCTGGG - Intronic
995989368 5:118217725-118217747 ATATATACAAATTTGGAGGAAGG + Intergenic
996195392 5:120600140-120600162 AATTAAACAAAAATGGAGCTGGG - Intronic
996350716 5:122538616-122538638 AAAAATACAAAACTTTAGCTGGG + Intergenic
997110441 5:131068561-131068583 AAATAGGGAAATCTGGTGCTGGG - Intergenic
998869060 5:146534655-146534677 AAAGATACATAGCTTGAGCTGGG + Intergenic
999895833 5:156032555-156032577 AAATATACAAAACATTAGCTGGG + Intronic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1003163556 6:3656647-3656669 ACTTTTACAATTCTGGAGCTGGG + Intergenic
1004777789 6:18868051-18868073 AAAAATACAAAAAAGGAGCTGGG + Intergenic
1004938439 6:20530604-20530626 AATTATAAAAATCTGGGGCCAGG - Intergenic
1005198199 6:23313293-23313315 AAATAGACAAACTTGGAGATGGG + Intergenic
1005614694 6:27561355-27561377 AGAAATACAAAGCTGGAGCCGGG - Intergenic
1006915747 6:37592905-37592927 CAATATAGAAATTTGGGGCTGGG + Intergenic
1007580442 6:42956069-42956091 AAATATATAAATCTCAGGCTGGG + Intergenic
1007831414 6:44641624-44641646 CAATAGACAAAGCTGGAGTTTGG - Intergenic
1008003463 6:46385335-46385357 AAAGATGCAAATTTGGAGCAGGG - Intronic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1009280753 6:61748148-61748170 AAAAATACAAATCATTAGCTGGG - Intronic
1009432440 6:63580531-63580553 AAATATACAAGTATTGTGCTGGG - Exonic
1009963689 6:70555221-70555243 AAAAAAACACATCTGGAGGTTGG + Intronic
1010296481 6:74203369-74203391 AAATAGACAAATCTTTCGCTAGG - Intergenic
1010656810 6:78521142-78521164 AAATATATATATATGTAGCTTGG - Intergenic
1011071308 6:83387950-83387972 AAATATATGGATCTGGAACTTGG - Intronic
1011247634 6:85336362-85336384 AATTATACAAATCTTCATCTTGG - Intergenic
1013092574 6:106913408-106913430 AAATATACAAAACTGTAGAAGGG - Intergenic
1013253839 6:108362799-108362821 AAATATACAATTCTAGAGCTGGG + Intronic
1013704924 6:112821166-112821188 AAACATACAAATGTTGAACTTGG - Intergenic
1015895442 6:138012291-138012313 AAATAAAGAATTCTGGGGCTGGG + Intergenic
1015935165 6:138401915-138401937 AAGAATACAAATCTGGGGTTTGG + Intergenic
1016441436 6:144088229-144088251 AAATACCGAAACCTGGAGCTGGG - Intergenic
1016931436 6:149414523-149414545 ACATATATATATCTGGAGCCAGG - Intergenic
1016968714 6:149742880-149742902 AAATATACATATCTGGCCCACGG + Intronic
1017565544 6:155681308-155681330 AAATACATAAATCTGGAGATGGG + Intergenic
1017877859 6:158538310-158538332 AAATATAAAAATCAGGTGATGGG - Intronic
1018002723 6:159594011-159594033 AATTATTCAAATATGGAACTAGG - Intergenic
1018316967 6:162566371-162566393 AAATAGACAAATCTTTAGCCAGG + Intronic
1019129199 6:169861055-169861077 AAACATTCAAATTTTGAGCTTGG + Intergenic
1019533952 7:1518179-1518201 AAATAAATAAATCAGGGGCTGGG - Intergenic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020417371 7:7961339-7961361 GAATATACAAATATGAATCTTGG + Intronic
1021349742 7:19576976-19576998 AAATATAAAAATGTGGAAATAGG + Intergenic
1021595609 7:22313150-22313172 AAATTTTCAACTCTGGAGATTGG - Intronic
1021829912 7:24595340-24595362 GGAAATACAAATCTGAAGCTTGG + Intronic
1022135284 7:27441746-27441768 AAATAGAAATGTCTGGAGCTTGG - Intergenic
1022970587 7:35513368-35513390 AAATAAACAGCTCTGCAGCTGGG - Intergenic
1023473250 7:40548625-40548647 AAATGTACAACTCTGGGGGTGGG - Intronic
1024808219 7:53175089-53175111 AAATCAACAAATCTGAAGGTTGG - Intergenic
1024908330 7:54414820-54414842 ATATATATATATCTGGAGCAAGG + Intergenic
1025966586 7:66278621-66278643 AAATATACAAAAAAGTAGCTGGG + Intronic
1026029463 7:66777626-66777648 AAAGAAACATTTCTGGAGCTGGG + Intronic
1026125891 7:67579181-67579203 AAAAATACAAAAATTGAGCTGGG + Intergenic
1026137225 7:67674138-67674160 ACATATAAAAATCAGAAGCTTGG + Intergenic
1026353309 7:69536143-69536165 AAAAAAAAAAATCTGGAGATAGG - Intergenic
1026885585 7:73941708-73941730 TAATATACAACTCTGGAAATAGG + Intergenic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027208785 7:76126520-76126542 AAAGAAACAATTCTGGAGCTGGG - Intergenic
1027473318 7:78599234-78599256 AAGTATACAAAAATGGAACTGGG - Intronic
1028047701 7:86143470-86143492 AAATATACAAACCTACATCTTGG - Intergenic
1028126564 7:87119930-87119952 AAAAAAATAAATCTGGGGCTGGG + Intergenic
1028612709 7:92730138-92730160 AAATAGACAATTCTGGATATAGG + Intronic
1028613614 7:92739311-92739333 AAGTTTGCACATCTGGAGCTTGG - Intronic
1029235521 7:99113677-99113699 AAAAATACAAAACAGTAGCTGGG + Intronic
1029433759 7:100549660-100549682 AAATAAACAAATATTGAGCATGG - Intronic
1030823444 7:114124302-114124324 AACTTTTCAAATCTGGAGATTGG - Intronic
1031436918 7:121743460-121743482 AATGATACACATTTGGAGCTGGG - Intergenic
1032379518 7:131462441-131462463 AAATATTCAAATCTTGACCTGGG - Intronic
1033919272 7:146368716-146368738 AAATAAACAAAACTGGGGATAGG - Intronic
1034209019 7:149346088-149346110 AAATTTACAAATCTTTAGCTAGG + Intergenic
1034331902 7:150290061-150290083 AAACTTGCAAATGTGGAGCTGGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034666136 7:152819809-152819831 AAACTTGCAAATGTGGAGCTGGG + Intronic
1034710138 7:153184003-153184025 AAATATACAAAAAAGTAGCTGGG + Intergenic
1034928057 7:155139355-155139377 AAACAAATAAATCTGGAGATAGG + Intergenic
1035004813 7:155648207-155648229 AAATATACAAAAGTGGAGGTGGG - Intronic
1036163488 8:6409724-6409746 GGATATACAAGTCTGGAGCTTGG + Intronic
1036742818 8:11380432-11380454 AAATATACCACTCTGGTGCCTGG - Intergenic
1037165567 8:15824384-15824406 ATATATACAAACTTGGTGCTAGG + Intergenic
1037576677 8:20212013-20212035 AACAATTCAAATCTGTAGCTTGG + Intronic
1038006920 8:23439038-23439060 AAATAAAAAAATCTGAATCTGGG - Intronic
1039328051 8:36506342-36506364 GACTCTACAAAGCTGGAGCTGGG + Intergenic
1039514023 8:38116203-38116225 AAAAATACAAAACTTTAGCTGGG + Intronic
1040020914 8:42740098-42740120 AAATATAGAAATTTAGAGCAGGG - Intergenic
1040701534 8:50071771-50071793 AAATATACATATTTTAAGCTGGG - Intronic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1042353600 8:67802378-67802400 ATATATACGAGTCTGGAGTTAGG + Intergenic
1043196853 8:77305108-77305130 CAAAATACAAAACTGGAGTTGGG - Intergenic
1043641844 8:82462547-82462569 AAATAAAATAATCTGTAGCTTGG - Intergenic
1043732087 8:83695196-83695218 AAATATATAAATCTGGAACTTGG + Intergenic
1043981966 8:86653392-86653414 AAAAATACAAATCTGGGTTTAGG - Intronic
1043991550 8:86762006-86762028 AAAAATACAAATCTGAAGAAAGG - Intergenic
1044358381 8:91253134-91253156 ATATATACAAAACTGAAGTTGGG + Intronic
1044916118 8:97114085-97114107 AATTACACAAATCTGGTGCCTGG - Intronic
1048061513 8:130924065-130924087 AATTGCACAAATCTGGAGTTGGG + Intronic
1050853682 9:10322787-10322809 AAATAAACACATTTGGACCTGGG + Intronic
1051203087 9:14651825-14651847 AAATAGTCAAATATGGACCTTGG + Intronic
1052676325 9:31629890-31629912 ATTTATATAAATCTGGAGTTTGG + Intergenic
1052908098 9:33854869-33854891 AAATAAAAAAATGTGGAGGTGGG - Intronic
1054746098 9:68855427-68855449 TAACATACAAGTCTGGAGCTTGG - Intronic
1054856124 9:69901296-69901318 AAATATACAAAAATTTAGCTGGG - Intronic
1055110368 9:72553266-72553288 AAATATACAGAATTGGAGCCAGG - Intronic
1056221345 9:84453228-84453250 AAATATACAAAACATTAGCTGGG - Intergenic
1057472166 9:95367644-95367666 GAATCTAGAAATCTGAAGCTTGG + Intergenic
1058983656 9:110192588-110192610 AAATGTGCTAATCTGGATCTGGG + Intronic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1059400801 9:114069801-114069823 AAAGATACAAATCCGGGTCTAGG - Intronic
1059402933 9:114081834-114081856 AAATCCACAGGTCTGGAGCTTGG + Intergenic
1059777012 9:117486180-117486202 AAATTTAGAAATTTAGAGCTGGG - Intergenic
1060874874 9:127075519-127075541 AAATAAACAAATCTGTCCCTGGG - Intronic
1061010674 9:127952695-127952717 AAATAAACAGATTTGCAGCTTGG - Intronic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1061142726 9:128778221-128778243 AAATATACAAAAAAGTAGCTGGG + Intergenic
1061175175 9:128991147-128991169 AAAAAAAGAAATCTGGAGCATGG - Intronic
1061177110 9:129004321-129004343 AAACACACACAACTGGAGCTGGG + Intronic
1061930547 9:133830687-133830709 GAATTTTCAAAGCTGGAGCTGGG - Intronic
1185705089 X:2260870-2260892 AATTATACATATTTGGAGTTAGG + Intronic
1185832259 X:3313553-3313575 AAAAATACAAATATTGAGCCAGG - Intronic
1185847955 X:3457410-3457432 ATATATGCAAGTCTGGAGTTTGG - Intergenic
1185953454 X:4462343-4462365 ACATATAAAAATTTGGAGTTAGG - Intergenic
1187042181 X:15608503-15608525 GGATATACAAATCTGGAGTTTGG + Intergenic
1187517305 X:19983909-19983931 AAATATAAAAAAATGTAGCTGGG + Intergenic
1188598772 X:31934736-31934758 AAATCAAGAGATCTGGAGCTCGG + Intronic
1189001134 X:36948255-36948277 AAATATGCTAATCTCTAGCTAGG - Intergenic
1189360592 X:40347694-40347716 AAATTTACAAACCTTTAGCTAGG - Intergenic
1189617576 X:42799751-42799773 AAAAAAAAAAGTCTGGAGCTAGG - Intergenic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190852861 X:54263801-54263823 AAATATAAAAATATGGAAGTGGG - Intronic
1192151241 X:68713811-68713833 GAATATATGAATCTGGAGCTTGG - Intronic
1192778234 X:74267132-74267154 ATACATACAAATATGTAGCTGGG + Intergenic
1193617495 X:83708383-83708405 AGATATACAAATCTCTAGCCAGG + Intergenic
1194291552 X:92079099-92079121 AAATTTACAGTTCTGGAGGTTGG + Intronic
1194690120 X:96973988-96974010 AAATATACAAATATTTGGCTGGG - Intronic
1195129927 X:101841547-101841569 AAATATACATATCTGCAGGAAGG + Exonic
1195176297 X:102318237-102318259 AAATATACATATCTGCAGGAAGG - Exonic
1195182567 X:102368856-102368878 AAATATACATATCTGCAGGAAGG + Exonic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1197657456 X:129132558-129132580 GGATATACAAATCTGGAGTTTGG + Intergenic
1200609070 Y:5303681-5303703 AAATTTACAGTTCTGGAGGTTGG + Intronic
1200815896 Y:7531958-7531980 ATATAGGCAAATCTGGAGATTGG + Intergenic
1201906613 Y:19092182-19092204 AAAAATAAAAAACTGGGGCTGGG - Intergenic