ID: 951359297

View in Genome Browser
Species Human (GRCh38)
Location 3:21705548-21705570
Sequence CTACCTACGTGGGCATGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951359292_951359297 9 Left 951359292 3:21705516-21705538 CCTACAGCTTTCAATTTGTGTAA 0: 1
1: 0
2: 2
3: 25
4: 261
Right 951359297 3:21705548-21705570 CTACCTACGTGGGCATGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951359297 Original CRISPR CTACCTACGTGGGCATGGGA AGG Intronic
900705215 1:4076271-4076293 CTACCCCTGTGGGCATGGAAAGG + Intergenic
904131805 1:28281057-28281079 CTGCCTCTGTGGGCAGGGGAAGG - Exonic
905798820 1:40830644-40830666 CTACCTCCGTGTGCATGGCCAGG + Intronic
907552626 1:55317293-55317315 CTAGCTATGTGGTCTTGGGAGGG - Intergenic
907704428 1:56820276-56820298 CTACCTATGTGACCATGGGCAGG - Intergenic
912567096 1:110595523-110595545 CTACCTAGATGGGAGTGGGAGGG - Intronic
913158907 1:116128010-116128032 CATCCTACGTGGGGATGAGAAGG - Intronic
919360963 1:196594053-196594075 CTACCTATGTGAGTATGAGATGG + Intronic
920649502 1:207826194-207826216 GTACCAACGGGGTCATGGGAAGG - Intergenic
920877921 1:209854652-209854674 CTGCTCACGTGGGCTTGGGAAGG - Exonic
922791045 1:228311268-228311290 ACACCTACCTGGGCCTGGGATGG - Intronic
1068003954 10:51370857-51370879 CTACCTACATGGCCATGCGTAGG + Intronic
1069115904 10:64506340-64506362 CTCCCTATGTGGGCATGGCTAGG + Intergenic
1069484464 10:68812671-68812693 CTACCTCAGTGGGGACGGGAAGG + Intergenic
1070131271 10:73656995-73657017 ATACATACGTGGTCATGGAAAGG + Intronic
1071526762 10:86363775-86363797 CTGCCTAGGTGGGCCGGGGAAGG + Intronic
1074261055 10:111853582-111853604 CTACCTACTAGGGAAAGGGAAGG + Intergenic
1078564725 11:12404568-12404590 ATCCCTTCATGGGCATGGGATGG + Intronic
1079344612 11:19641130-19641152 CCTCCCAGGTGGGCATGGGATGG - Intronic
1083143409 11:60739892-60739914 CTAACCAAGTGGGCAAGGGAAGG + Intronic
1084626663 11:70312926-70312948 CTTCCCACGTGGGCATGGACAGG - Intronic
1085365828 11:75943178-75943200 CTACCAAAGTGGGGGTGGGAGGG - Intronic
1089096619 11:115925029-115925051 CTACCTCAGTGTGCAAGGGAAGG - Intergenic
1090204929 11:124878782-124878804 CTCCCTACCTGGGCATCTGATGG - Exonic
1090226855 11:125076898-125076920 CAACCTCGGTGGCCATGGGAAGG - Intronic
1095667517 12:44819742-44819764 CTACCTCTATGGGGATGGGATGG + Intronic
1097079639 12:56420741-56420763 AGACCTACCTGGTCATGGGATGG - Intronic
1098168474 12:67721273-67721295 CTACCAACATGGGCTTGCGATGG + Intergenic
1104154750 12:126120679-126120701 GTACCGACGTGGGCAAGGGTGGG - Intergenic
1105269652 13:18859968-18859990 CAGCCTACATGGACATGGGAAGG + Intergenic
1110078939 13:71286746-71286768 CTAGCTATGTGGCTATGGGAAGG - Intergenic
1113730686 13:112639088-112639110 CTACCTACATGGCCATAGCATGG - Intergenic
1115582813 14:34778220-34778242 CTAGCTAGGTGGAAATGGGAAGG - Intronic
1117391724 14:55269015-55269037 CTCCCCAGGTGGGCATGGGGTGG - Intergenic
1118764723 14:68902122-68902144 CAACAGACGTGGGCATGGAAGGG + Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1129020780 15:72515699-72515721 CAACCAAAGTGGGAATGGGAGGG - Intronic
1132844489 16:1993501-1993523 CTACCCACAGGGACATGGGATGG - Exonic
1144792780 17:17870527-17870549 CCACCTACCTGGGCACTGGAGGG + Intronic
1145252509 17:21304294-21304316 CTGCCCACTGGGGCATGGGAGGG + Intronic
1146608824 17:34286800-34286822 AGACCTACGTGGCCATGTGATGG - Intronic
1152300829 17:79494678-79494700 CTCCTTGCCTGGGCATGGGAGGG - Intronic
1157443317 18:47726430-47726452 CTACCTCCACGGGAATGGGATGG - Intergenic
1160532992 18:79576501-79576523 CTACCTCCGTGGGCCTTGGCCGG + Intergenic
1160905817 19:1451343-1451365 CCACCTGGCTGGGCATGGGATGG + Exonic
1161866651 19:6837283-6837305 CTTCCTACATGGGTATGGTAGGG + Intronic
1162450212 19:10749868-10749890 CTGCCTACCTGGCCATGGGCAGG - Intronic
1163112197 19:15168276-15168298 ATACCTACTTTGGGATGGGAAGG + Intronic
1167535356 19:50047301-50047323 CTACCTAAGTGACCTTGGGAAGG + Exonic
930991552 2:57662541-57662563 CTACTTACATGGGCATTGGAAGG + Intergenic
938036185 2:128036983-128037005 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
938036991 2:128043051-128043073 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
938081337 2:128371796-128371818 CTACCTGTGTGGCCTTGGGAAGG + Intergenic
938309206 2:130275821-130275843 TTACATACGTAGGGATGGGAGGG - Intergenic
942143641 2:173003249-173003271 CTCCCTACCTGGGCATGGAACGG - Intronic
948742944 2:240060155-240060177 CTCCCTGGGTGGGCGTGGGAAGG - Intergenic
1172175809 20:32971137-32971159 GAACCAACGTGGGCATGGGATGG + Intergenic
1176854907 21:13959275-13959297 CAGCCTACATGGACATGGGAAGG + Intergenic
950958404 3:17079429-17079451 CTACAGACCTGGCCATGGGAAGG - Intronic
951359297 3:21705548-21705570 CTACCTACGTGGGCATGGGAAGG + Intronic
953207892 3:40848110-40848132 CTCCCCACATGGGCATGGCAGGG - Intergenic
957657115 3:83094444-83094466 CAACCTACGTGGGGATGTGTTGG + Intergenic
961500486 3:127329593-127329615 CTACCTACAGAGGCATGGGCAGG - Intergenic
963064878 3:141255772-141255794 CTACCTACCTGGAGATGGAAAGG + Intronic
967631218 3:191744328-191744350 CTCCCTTTGTGGGCATGGGTGGG + Intergenic
969767315 4:9239657-9239679 CTACCTGCTTGTGCCTGGGAAGG - Intronic
970353345 4:15228144-15228166 CTAGCTACGTGGGCAGCCGATGG + Intergenic
976090400 4:81451379-81451401 CTACCTACATTGACATGGAAGGG + Intronic
978184758 4:105843997-105844019 CTACCTTTGTGGGCCTGGGGAGG - Intronic
986041711 5:4000098-4000120 CAACCTACTTAGGCATGTGAGGG + Intergenic
992901587 5:81301953-81301975 CTACGTACGTGGGAAGGGGGAGG - Exonic
1001108223 5:168873768-168873790 CTACCTATGTGAGCTTGGGCAGG - Intronic
1007396891 6:41583140-41583162 CTATCCACATGGGCCTGGGAGGG - Intronic
1012643871 6:101655776-101655798 CTATCTAAATGTGCATGGGAAGG + Intronic
1013615843 6:111842373-111842395 CTTCCTGAGTGGGCATGGGCGGG - Intronic
1015394102 6:132716072-132716094 CCACCCACCTGGGCATGGAAAGG - Intergenic
1029595599 7:101535992-101536014 CAACATACGTGGGCATGGAGTGG - Intronic
1035164078 7:156973938-156973960 CTACCTGCATTGGCAGGGGAGGG + Intergenic
1039669645 8:39581735-39581757 CTGCCTATGTGGGCAGGGAATGG - Intergenic
1048274791 8:133058170-133058192 CTACCTACTTGAGTAAGGGAGGG - Intronic
1049062956 8:140290362-140290384 GGACCTACATCGGCATGGGAGGG + Intronic
1050088367 9:1990783-1990805 GAAGGTACGTGGGCATGGGATGG + Intergenic
1053203578 9:36168727-36168749 CCACAAACGGGGGCATGGGAGGG - Intergenic
1057439419 9:95072214-95072236 GTAAATACGTGGGCATGGCATGG - Intronic
1193372110 X:80711288-80711310 CTGCAGAGGTGGGCATGGGAGGG + Intronic
1198641461 X:138760505-138760527 CCACCAAGGTGGGCAGGGGAGGG + Intronic