ID: 951362021

View in Genome Browser
Species Human (GRCh38)
Location 3:21736703-21736725
Sequence ATAGAGAAGTAGACTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 409}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951362015_951362021 18 Left 951362015 3:21736662-21736684 CCAGACTAACATCCATATGGAAT 0: 1
1: 0
2: 0
3: 16
4: 184
Right 951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG 0: 1
1: 1
2: 2
3: 30
4: 409
951362016_951362021 6 Left 951362016 3:21736674-21736696 CCATATGGAATTAGCAGAATAGA 0: 1
1: 0
2: 0
3: 12
4: 158
Right 951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG 0: 1
1: 1
2: 2
3: 30
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951362021 Original CRISPR ATAGAGAAGTAGACTGGGGA GGG Intronic
900894321 1:5472830-5472852 ACAGATAAGTAAACTGTGGAAGG + Intergenic
901243603 1:7710719-7710741 ATAGAGGAGGAGAGTGGGGTGGG - Intronic
901257707 1:7845722-7845744 ACAGAGAAGTAAACTGAGGCAGG + Intronic
901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG + Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
901988424 1:13093293-13093315 ATTGAGCAATAGAATGGGGAAGG + Intergenic
901993388 1:13133474-13133496 ATTGAGCAATAGAATGGGGAAGG - Intergenic
902365986 1:15974869-15974891 ATAAAGAAGCAGACTGGGCCGGG - Intronic
902429266 1:16350454-16350476 ATAGAAAAGGAGGCTGGGCACGG + Intronic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903277387 1:22230866-22230888 ATAGATAAGTAAACTATGGATGG - Intergenic
903517672 1:23922933-23922955 ATAGAGAGTTAGAATGGGGCTGG - Intergenic
903679313 1:25086770-25086792 AGAGAGAGGTGGCCTGGGGAGGG - Intergenic
904357090 1:29947337-29947359 ATAGATAAGAAGACTGAGGCTGG - Intergenic
904424234 1:30413310-30413332 ATAATGAAGAAGATTGGGGAGGG + Intergenic
904797696 1:33069822-33069844 ATATAGAATGAGAGTGGGGAAGG - Intronic
906428809 1:45737614-45737636 ATAGAAAAATTGGCTGGGGATGG - Intronic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
908440843 1:64152294-64152316 CTAGAGGAGAAGAATGGGGAAGG - Intronic
908794744 1:67819923-67819945 ACAGAGAGATGGACTGGGGATGG - Intronic
909509254 1:76432745-76432767 ATACAAAAGTAGGCTGGGCATGG - Intronic
910500663 1:87886533-87886555 ATAGAAAAGTGGGCTGGAGAAGG + Intergenic
911382161 1:97128891-97128913 AGAGAAAAGTAGAGTGTGGATGG + Intronic
911478036 1:98398016-98398038 ATAGAGCAGTATAGTGGGAAAGG + Intergenic
912142253 1:106744936-106744958 AAGGAGAAGTAGACTGGGATTGG + Intergenic
912782353 1:112563002-112563024 TCAGAGAAGTAGAATTGGGAGGG + Intronic
913092713 1:115490463-115490485 ATAGAAAAGTCGGCTGGGCATGG + Intergenic
913718932 1:121571310-121571332 ATAGAAAAGGAGACTGAGGTAGG - Intergenic
915084104 1:153373037-153373059 GTAGAGAAGTAGAGTTGGGGTGG - Intergenic
915365266 1:155311595-155311617 ATGGGGAAGGAAACTGGGGAGGG + Intronic
916339430 1:163712697-163712719 ATTGAGAAGAAGCCTGGGCATGG + Intergenic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916495134 1:165339802-165339824 ATAGAGGAGAAGCCTAGGGAAGG - Intronic
917632028 1:176899688-176899710 CTTGAGCAGTAGACTGGGGTGGG - Intronic
918011432 1:180590561-180590583 ATAGAGAGGTAGGCAGGGGCTGG + Intergenic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918754662 1:188324231-188324253 ATAGTGAAGGAGATTGGGGCAGG + Intergenic
919501292 1:198341142-198341164 TTACAGAAGTAGTCTGGGAATGG - Intergenic
920181952 1:204137481-204137503 AGAGAGAGGTAGACTGGTTAAGG + Intronic
921038796 1:211409020-211409042 AAAGAGAAGAAGTCTGGGCATGG + Intergenic
921281106 1:213569040-213569062 AGTGGGAAGTACACTGGGGAGGG - Intergenic
923964726 1:239124827-239124849 ACAGAGAAAGAGACTAGGGAAGG + Intergenic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1063109385 10:3021262-3021284 TTAGAGAGGAAGACTGGAGATGG - Intergenic
1063585978 10:7352713-7352735 ATAAATAAGTACACTGGGGCCGG + Intronic
1064226359 10:13489169-13489191 AGAGAGAAATGGAGTGGGGAGGG + Intronic
1064606984 10:17052464-17052486 AGAGAGAAGTAGGCTGGGTGCGG + Intronic
1065462100 10:25979478-25979500 ACACAGAAGTACACTTGGGAGGG - Intronic
1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG + Intergenic
1068080246 10:52310564-52310586 ATACAGCAGTAGACTGGGCGCGG + Intergenic
1069519904 10:69110641-69110663 AGAGAGAAGTAGCCTGAGGTTGG + Intergenic
1069883573 10:71609271-71609293 AGAGAGAAGTGGACTGGGAGGGG - Intronic
1070992410 10:80744128-80744150 AAAGAGAAGTAGGCTGGGCGCGG + Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071806283 10:89124633-89124655 ATAGAGCTGTGGCCTGGGGAAGG + Intergenic
1072402985 10:95124618-95124640 ATAGGGAAGTAGAGAGGGAAGGG + Intergenic
1073276720 10:102318185-102318207 ATAAATAAATAGACTGGGCATGG - Intronic
1074001791 10:109380821-109380843 ACAGAGAAGTGGAGTGGGTATGG - Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074400824 10:113140225-113140247 ACAGAGTAGTGGAGTGGGGAGGG + Intronic
1074476335 10:113778105-113778127 AAAGAAAAGTAGACCAGGGAAGG - Intronic
1075021126 10:118953177-118953199 GCAGAGATGTACACTGGGGAGGG - Intergenic
1075851905 10:125595794-125595816 GCAGAGAAGTAAACAGGGGAAGG - Intronic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076282948 10:129265271-129265293 TTAGAGGAGTAGGCTGGGCATGG + Intergenic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1077510890 11:2961820-2961842 ATAGAAAAGTAGGCTGGGTGTGG - Intronic
1078392078 11:10944009-10944031 CTAGAGAAGTAGAGTGAGGGTGG - Intergenic
1079461687 11:20685804-20685826 AAAAAGCAGAAGACTGGGGAAGG + Intronic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079866724 11:25745394-25745416 ATAGAAAAGTTGACTTGGAAGGG - Intergenic
1082016328 11:47491151-47491173 ATAAAGAAATAGGCTGGGCACGG - Intronic
1082114571 11:48314418-48314440 GTAGAGAAGGAGACAGGGGTAGG - Intergenic
1082856697 11:57814642-57814664 CCAGAGAAGGAGACTGGGGTAGG - Intronic
1082888877 11:58117340-58117362 ATACAGCAGTAGACAAGGGATGG - Intronic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1084393904 11:68896514-68896536 AGAGAGAATTCGACTGGAGAAGG - Exonic
1086321452 11:85651871-85651893 AAAGAGTAGTAGGCTGGGCATGG + Intronic
1088194417 11:107259379-107259401 ACAGAGAAGTGTATTGGGGAAGG - Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088460483 11:110077182-110077204 ATAGTGAAGTAATTTGGGGAAGG + Intergenic
1088888499 11:114026459-114026481 ATAGAAAAGTGGGCTGGGTATGG + Intergenic
1089771850 11:120808875-120808897 ACAGAGATGTGCACTGGGGAGGG - Intronic
1090480225 11:127061407-127061429 ATAGGGAAGTGCACTGGGCAAGG - Intergenic
1090640618 11:128726298-128726320 ATAGAGTAGGAGTCTGGGGCTGG - Intronic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1093785609 12:23188651-23188673 AAAGAGAAGTAGACCTGGGCAGG + Intergenic
1094341686 12:29419146-29419168 TTAGAAATGTAGACTGGGCATGG - Intronic
1094455906 12:30632653-30632675 ATAGAGACCTGGAATGGGGAGGG - Intronic
1097668240 12:62506000-62506022 GTGGAGAAGTAGAGTTGGGATGG + Intronic
1098140233 12:67443535-67443557 GTAGAGAAGAAGGCTGGGAATGG + Intergenic
1100552998 12:95664346-95664368 ATAAATAAATAGACTGGGCATGG - Intronic
1101256513 12:102982876-102982898 TTAGAGAAGTGGAGTGGGGAAGG + Intergenic
1101598886 12:106191267-106191289 TTAGAGGACTGGACTGGGGAGGG - Intergenic
1103680752 12:122691654-122691676 TTACAGAAGTAAAGTGGGGAAGG + Intergenic
1106195090 13:27486730-27486752 ATAGATAAGTTGAGTGGGTATGG - Intergenic
1106535967 13:30643345-30643367 ATAAAGAGGTAACCTGGGGATGG - Intronic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108387585 13:49914718-49914740 ATAGAGATGTAGAGTTGGGTGGG - Exonic
1112108447 13:96267791-96267813 ACAGGGAAGTAGGCAGGGGAAGG + Intronic
1112499246 13:99929844-99929866 ATATAAAAGTTGACTGGGCACGG - Intergenic
1113340373 13:109417142-109417164 ATAGATAATTAGACAGAGGATGG - Intergenic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1114533710 14:23410375-23410397 GGAGAGAAGGAGCCTGGGGAAGG - Intergenic
1115178063 14:30588072-30588094 ATAGAGTAGTAGACTGGCCTGGG + Intronic
1115631531 14:35250651-35250673 GTAGAGAGGTAGATTGAGGAAGG + Intronic
1117594617 14:57313719-57313741 ATAGACCAATAGAGTGGGGATGG + Intergenic
1119055105 14:71411474-71411496 AGAGAGAAGACAACTGGGGAAGG - Intronic
1120930056 14:89839343-89839365 AGAGCAAAGTAGAATGGGGATGG + Intronic
1121037041 14:90714882-90714904 ATAGAGATGAAAATTGGGGAGGG - Intronic
1121097360 14:91226967-91226989 ATTGAGAAGGAGGCTGGGCATGG + Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1122879588 14:104684216-104684238 ACCGAGAAGGAGGCTGGGGAGGG + Intergenic
1124141776 15:27083614-27083636 ATAGAAAAGTTGGCTGGGCACGG - Intronic
1125718659 15:41834712-41834734 AGAAAGAAGAAGACAGGGGATGG - Intronic
1125800140 15:42438498-42438520 ATAGAATAGGAGAATGGGGAGGG - Intronic
1126891726 15:53212800-53212822 ATAGAGCAGTGGTGTGGGGAAGG - Intergenic
1128093162 15:64932792-64932814 AAAGAAAAGTAGGCTGGGCAAGG + Intronic
1128253290 15:66178785-66178807 AGAGAGAAGGAGAGTGGGGGTGG + Intronic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1129786315 15:78312593-78312615 ATAGAGGTGGAGACTGGGGGAGG - Intergenic
1130018096 15:80202672-80202694 ACAGAGGAATAGACTGAGGAGGG + Intergenic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1130358816 15:83161113-83161135 ATAGAGTCAAAGACTGGGGAAGG - Intronic
1131262424 15:90894292-90894314 ATACAAAAATAGACTGGGCACGG + Intronic
1131408104 15:92183275-92183297 AGACAGAAGTAGTATGGGGAGGG - Intergenic
1202970842 15_KI270727v1_random:236916-236938 AAAAAGAAGTAGGCTGGGCATGG + Intergenic
1133210069 16:4258565-4258587 ATACAGAAGTTAGCTGGGGATGG - Intronic
1133608723 16:7413327-7413349 CTACAGAGGAAGACTGGGGAAGG - Intronic
1133830519 16:9319214-9319236 ACAGAAAACTAGACTAGGGAAGG - Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135412569 16:22246229-22246251 GTACAGAAGAAGACTGGGCATGG + Intronic
1135417397 16:22279027-22279049 GTAGAGAAGTGGATTGGGGGCGG - Intronic
1136452783 16:30363423-30363445 ATAGAGAATGTGAGTGGGGATGG - Intronic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1139268264 16:65659623-65659645 ATAGAGAACTTCCCTGGGGAGGG + Intergenic
1139897212 16:70297202-70297224 ATAAATAAATAGACTGGGCACGG - Intronic
1141871463 16:86789342-86789364 AGAGTGAAGTGGAGTGGGGAGGG - Intergenic
1143049071 17:4107752-4107774 ATAAAGAAATAGGCTGGGCATGG + Intronic
1143172480 17:4938241-4938263 TCAGAGAAGTAGCCTGGGGGAGG + Exonic
1143254728 17:5547469-5547491 ATAAAGAAATGGGCTGGGGAAGG - Intronic
1143332632 17:6148891-6148913 TTAGAGAAGGAGGCTGGGGGTGG - Intergenic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1144131513 17:12251191-12251213 ATAGAGGAGGTGGCTGGGGATGG + Intergenic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1146435597 17:32843178-32843200 AAATAGACGTAGACTGGGCATGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146960656 17:36973778-36973800 ATAGCCAAGCAGGCTGGGGACGG + Intronic
1147321505 17:39648946-39648968 ACACAGAAGTAGACTGGAGTAGG + Intronic
1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG + Intronic
1147544360 17:41389054-41389076 ATAAAGAAATAAACTGGGAAAGG + Intronic
1148401325 17:47364198-47364220 ATAGAGAAGTAGAGTTGCCAAGG - Intronic
1149065430 17:52473730-52473752 ATTGAGCCGTTGACTGGGGAAGG - Intergenic
1149284876 17:55151229-55151251 AGTTAGAAGTAGAGTGGGGAGGG + Intronic
1149412866 17:56427063-56427085 AGAGGGAAGAAGACTGGGGCTGG + Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150368305 17:64611609-64611631 AGAGAGAAGTAGACAGATGAAGG - Intronic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1156100997 18:33594634-33594656 AATGAGGAGTAAACTGGGGAGGG + Intronic
1156429669 18:37058420-37058442 ATAAACAAGTAGGCTGGGCATGG + Intronic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156686402 18:39652661-39652683 ATAGATAAGTAGATTATGGAAGG + Intergenic
1157847286 18:51015767-51015789 ATAGAGAATTAGATTGGGGGAGG - Intronic
1158709948 18:59828695-59828717 TTAGAGTAGTTGATTGGGGAGGG - Intergenic
1161423935 19:4191770-4191792 ATAAATAAATAGGCTGGGGACGG - Intronic
1161796364 19:6388949-6388971 ATAAATAAGTAGGCTGGGCACGG + Intronic
1162142049 19:8591037-8591059 AGTGAGAAGTTTACTGGGGAGGG - Intronic
1164442214 19:28287870-28287892 AGAGAGAAGGGGACTGGGAAGGG + Intergenic
1165840756 19:38788110-38788132 TTGGGGAAGTAGACTGGGGGAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167646695 19:50709839-50709861 ATAGAGAATTAGACCAGGCACGG - Intronic
1168067489 19:53926755-53926777 ATAGAAAAATTGACTGGGCATGG + Intronic
1168091085 19:54084829-54084851 ATAGAGAAGGCGGCTGGGCATGG + Intergenic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927652019 2:24919012-24919034 CTAGAGAAGTGGACTGGGAACGG + Exonic
927775902 2:25902937-25902959 ATAGAAATGTAGGCTGGGCACGG - Intergenic
927993541 2:27465569-27465591 ATACAGCAGAAGACTGGTGATGG + Intronic
928017383 2:27670496-27670518 TTAGGGAAGAAGACTGAGGATGG - Intronic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
930138815 2:47930994-47931016 ATAGAGATGGATACTGGTGATGG + Intergenic
931096247 2:58943844-58943866 AGAGAGAAGTAGAGAGGGAAGGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932867565 2:75361621-75361643 ATAGAGAAATACATTGGTGAAGG + Intergenic
933001773 2:76933903-76933925 ATATTGAAGTAAAATGGGGAAGG - Intronic
934018654 2:87919681-87919703 ATAGAGAAGTAGTGTGGGAAAGG + Intergenic
934939859 2:98492874-98492896 ATAGATAAGGAGCCTGGGGCTGG + Intronic
935824346 2:106929713-106929735 AAAGGGAAGTAAAGTGGGGAGGG - Intergenic
937650751 2:124316272-124316294 AAAGAGAACTAGCCTGGGGTCGG + Intronic
938199350 2:129360480-129360502 CTAGAGAAGCAGTGTGGGGAGGG - Intergenic
939155178 2:138516590-138516612 ATAGTGAAGAAAACTGTGGAGGG + Intronic
940112014 2:150165438-150165460 AAAGAGAGGTGGACTGGGGATGG + Intergenic
940927470 2:159381110-159381132 ATAGAGTAGTGGACTGAGGTTGG - Intronic
941428111 2:165375525-165375547 ATATAGAAGTAGTCAGGGAAGGG + Intronic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
942486096 2:176441469-176441491 AAAGAGAAGTAGAATAGAGATGG + Intergenic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
944385510 2:199159618-199159640 ATAGAGTATAAGACTGTGGATGG - Intergenic
944465204 2:199993724-199993746 GTAGAGAAGGGGACTGGGGGTGG + Intronic
945415304 2:209563550-209563572 CTAGAGAAGTATACGGGGGTGGG - Intronic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
948861183 2:240753279-240753301 ATAGAGAGGTAAACTGAGGCAGG + Intronic
1169607137 20:7334398-7334420 ATACAGAAGGGAACTGGGGAAGG + Intergenic
1169662291 20:7993263-7993285 AGACAGAAATAGACTAGGGATGG - Intronic
1170907537 20:20529246-20529268 AAAGAGAAGAGGACTGAGGAAGG - Intronic
1171011977 20:21513832-21513854 AAAGAGAAAGAAACTGGGGATGG + Exonic
1171508803 20:25662471-25662493 AGAGAGAAGTAGGGTGGGGTGGG + Intergenic
1172675972 20:36672536-36672558 ATAGAAAAGTAGGCTGGGCGTGG + Intronic
1172808767 20:37632231-37632253 GGAGAGAAATAGAGTGGGGATGG - Intergenic
1173010123 20:39174849-39174871 CTAGAGATGTTGCCTGGGGAGGG + Intergenic
1173803240 20:45908066-45908088 CTTGAGAATTAGACTGGAGAGGG - Intronic
1174428388 20:50449553-50449575 ATAGAAGAGGATACTGGGGATGG - Intergenic
1174717349 20:52773725-52773747 ATAGAGAAATTGGCTGGGTATGG - Intergenic
1174818622 20:53708734-53708756 AAAGAAAAGAAGACAGGGGAGGG - Intergenic
1174897236 20:54462622-54462644 AAGTAGGAGTAGACTGGGGAAGG + Intergenic
1175569785 20:60010074-60010096 ACATAGCAGTAGACTGGGGCGGG + Intronic
1175581128 20:60100669-60100691 ACAGAGAAGTAGATTTGGGGTGG - Intergenic
1177120679 21:17133243-17133265 ATAGAGCAGTCTTCTGGGGAAGG - Intergenic
1177477079 21:21637257-21637279 AGAGAATACTAGACTGGGGAGGG - Intergenic
1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG + Intergenic
1178291043 21:31368662-31368684 AAATATAAGTATACTGGGGACGG - Intronic
1180846785 22:18987322-18987344 ATAAATAAGTAGGCTGGGCACGG + Intergenic
1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG + Intergenic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952247781 3:31614408-31614430 ATGGACAAGGAAACTGGGGAGGG - Intronic
953211767 3:40881647-40881669 AAAAAGAACTAGACTGGGCACGG - Intergenic
953386648 3:42510079-42510101 TGAGAGATGTAGACTGGGGTAGG - Intronic
954009751 3:47625523-47625545 ATATAGAAGTAGGCTGGGCACGG - Intronic
954046995 3:47940535-47940557 CTATAAAAGTAGAATGGGGAAGG + Intronic
954079006 3:48201808-48201830 ATACAAAATTAGACTGGGCACGG + Intergenic
959058061 3:101587980-101588002 ATGGAGAAATTGACTGGGCATGG + Intronic
959532551 3:107450277-107450299 AGAGTTAAGTAGACTTGGGAGGG + Intergenic
960238223 3:115309771-115309793 AGACAGAAGTAGATTGGTGATGG - Intergenic
960274938 3:115718058-115718080 AAAGGGAAGTAGACTGGGAAAGG - Intronic
960419687 3:117428427-117428449 ATGGGGAAGTAGGCTGGGCATGG - Intergenic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
961018847 3:123487247-123487269 AGAGAGAAGTGGGCTGGGCACGG + Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961398962 3:126620785-126620807 ATAGGGAAGTACAATTGGGAAGG - Intronic
961836749 3:129667894-129667916 ATAGAGGAGTTGACGGGGTATGG + Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963524004 3:146393316-146393338 ATAGAAATGTAGGCTGGGCACGG - Intronic
964036232 3:152200757-152200779 ATAGAAAAGTAGACTTAGGGAGG - Intergenic
965280532 3:166746433-166746455 ATCTAGAAATAGGCTGGGGATGG + Intergenic
965785039 3:172326725-172326747 AACGAGAAAAAGACTGGGGAGGG - Intronic
966496015 3:180581647-180581669 ATAGAAAGGTATACTGGGGCAGG - Intergenic
966738008 3:183205418-183205440 AAATAGAATTAGACTGGGGATGG + Intronic
967669899 3:192220309-192220331 ATAGGGAAGTAGAATGGTGAAGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969937301 4:10695034-10695056 ATGGAGGAGTGGACTGGGAAAGG + Intergenic
970590848 4:17559609-17559631 ATGGTGGAGTAGACAGGGGAGGG - Intergenic
970855357 4:20644812-20644834 ATAAAGAAGTGTACTGGAGAGGG - Intergenic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971161418 4:24137617-24137639 ATGGACCAGTAGACTGGGCAAGG - Intergenic
971451239 4:26803907-26803929 AAAGAGAAGGGGACGGGGGAGGG + Intergenic
972392469 4:38626678-38626700 ATAAAGAATTAGGCTGGGCACGG - Intergenic
973783115 4:54308918-54308940 ATAGAGAAGAAAACTGTGGTAGG + Intergenic
973842150 4:54873322-54873344 TCACAGAAGCAGACTGGGGAGGG - Intergenic
974018800 4:56675007-56675029 GTAGAGAAGTTGGCTGGGCATGG - Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
975185068 4:71392346-71392368 TTAGAGCAGTAGCTTGGGGAGGG + Intronic
977463423 4:97355235-97355257 GTAGAAAAGGAGACTGGGCACGG + Intronic
977773584 4:100889967-100889989 AGAGAATAGTGGACTGGGGAAGG + Intergenic
977780826 4:100978691-100978713 ATACACAAGTAGAGTAGGGAGGG - Intergenic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
978856097 4:113396666-113396688 ATTGATAAGTAGGCCGGGGATGG - Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
981737757 4:147970795-147970817 ATAAAGATGTAGACTGAGCATGG + Intronic
982099441 4:151953742-151953764 ATAGAGAAGGGGTGTGGGGAAGG - Intergenic
982775505 4:159437535-159437557 ATAGAGAATTCGGCTGGGCACGG - Intergenic
983911757 4:173247709-173247731 ATAGAGAAGTAGATTTGTAAAGG + Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985520905 5:373619-373641 ACAGAGGAGGAGACTGGGGCTGG + Intronic
986642544 5:9886622-9886644 ATATAAAAATAGACTGGGAACGG - Intergenic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
988214408 5:28252651-28252673 ATAGATAATTAGACAGGGCAGGG - Intergenic
989272545 5:39550038-39550060 CTAGATAAGTAGGTTGGGGATGG - Intergenic
989372679 5:40725664-40725686 AGAGGGAAGGAGACTGGGAAAGG - Intronic
989632676 5:43502448-43502470 ATAGAGATTTATTCTGGGGATGG - Exonic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
989959668 5:50396758-50396780 ATAGAAAAGGAGACTGAGGTAGG + Exonic
990563775 5:57008784-57008806 ATAGAGAAGTTAGCTGGGCATGG + Intergenic
991341457 5:65615190-65615212 ATAGAGAAATAGGCTGGGCACGG - Intronic
991475896 5:67019157-67019179 ATATACAAGAAGACTGGGGCGGG + Intronic
991500110 5:67268454-67268476 AGAGAGAACAGGACTGGGGAAGG - Intergenic
991598084 5:68324702-68324724 ATATAGGAGGAGACTGGGGGCGG - Intergenic
991719738 5:69484301-69484323 ATAGAAATGTTGACTGGGCATGG - Intergenic
992441451 5:76800980-76801002 AGAGAGAATGAGGCTGGGGAGGG + Intergenic
993002893 5:82400011-82400033 TAAGAGAAGTAGAATGGGCAAGG - Intergenic
993317540 5:86429594-86429616 TAAGAGAAGTGGTCTGGGGATGG - Intergenic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
993564663 5:89458310-89458332 ATATAAAAGCAGACTGGGCAAGG - Intergenic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
994367684 5:98934059-98934081 GGAGAGAAGTAGAATTGGGAAGG + Intergenic
995019944 5:107354807-107354829 ATAGGGCAGTGAACTGGGGAAGG - Intergenic
995849156 5:116526217-116526239 ATAGAAAAGTGGAGTGGGGAGGG - Intronic
995900182 5:117056447-117056469 AGAGGGAAGTAGAGGGGGGAAGG + Intergenic
995972760 5:117992673-117992695 GTAGAGAAATAGATTGGGGTGGG + Intergenic
996484876 5:124021202-124021224 ATAGAGAAGTGGGTGGGGGAAGG - Intergenic
996925924 5:128826555-128826577 ATAGTTAAGAAGACAGGGGAAGG + Intronic
996963205 5:129276181-129276203 ATAGAAAAGGAGGCTGGGCATGG - Intergenic
997953193 5:138258147-138258169 AAAGAGGAGTAGGGTGGGGAAGG - Intronic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
999799217 5:155017737-155017759 AGAGAGCAGTAGTCTGGGGATGG - Exonic
999881851 5:155873503-155873525 ATAGACATGTAGACTTGGAAGGG + Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1000880265 5:166689334-166689356 AAAGTGAAATAGACTGGGTATGG - Intergenic
1001469541 5:172001099-172001121 ATAGAGAAGAAAGATGGGGAGGG - Intronic
1001670998 5:173473878-173473900 AAAGAGGAGGAGACTGGGAAAGG + Intergenic
1002521557 5:179795574-179795596 AGGGAGAAGTAGGCTGGGGGAGG - Exonic
1002895144 6:1374694-1374716 AGAGAGAAGTGGTATGGGGACGG - Intergenic
1003463080 6:6350688-6350710 ATATAGAAATAGACGGGGCATGG + Intergenic
1003514557 6:6807094-6807116 AAAGAGAAGTAAACAGGGGCGGG + Intergenic
1003786939 6:9497295-9497317 ATAGAGTAGTAGATTGTGTAAGG + Intergenic
1004700215 6:18071739-18071761 TTATAGAAGCAGACTGGGGTGGG - Intergenic
1005270609 6:24159487-24159509 AAAAAAAAGTAGACTTGGGAAGG + Intergenic
1006544618 6:34769481-34769503 ATAGTGAGGTAGGCTGGGGGTGG - Intronic
1006553117 6:34841363-34841385 ATAGAAATATAGACTGGGGCTGG - Intronic
1006690565 6:35880430-35880452 ATAGAGGAGGAGGCTGGGCACGG + Intronic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1006943012 6:37765455-37765477 ATAAAGCAGTAGACTGGCAAAGG + Intergenic
1007054600 6:38869814-38869836 TTGGAGCAGTAGACTGGGGCAGG + Intronic
1007059353 6:38923435-38923457 ATAGAGAACTGGAGTGGAGACGG - Intronic
1007587088 6:42997834-42997856 ATACAGAAGTTGGCTGGGCATGG - Intronic
1007756486 6:44102857-44102879 ATAGTGAAGGAGAATGGGGTAGG - Intergenic
1008573240 6:52834906-52834928 ATAGAGAATTTCACCGGGGAAGG - Intronic
1009518530 6:64652251-64652273 ATAGAGAAATTAACTGGGGGTGG + Intronic
1010162624 6:72875894-72875916 ATAGAAATGTAAACTGAGGAAGG - Intronic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011042705 6:83048190-83048212 ATAGAGGAGGAGACTTGGGCAGG + Intronic
1011501069 6:87990679-87990701 GTAGAGAAGTAGGCTGGAGGGGG + Intergenic
1011650524 6:89502353-89502375 AAAGAGAAATAGACTGGGCATGG + Intronic
1014340325 6:120197519-120197541 ACAGTGAAGTAGAGTGGAGATGG + Intergenic
1014742576 6:125163424-125163446 ATAAAGAAGTAAATTGGGCATGG + Intronic
1016868631 6:148795195-148795217 TTTGAGAAGTAGGCTTGGGATGG + Intronic
1016920734 6:149290455-149290477 CTAGTGAAGTAGAGTGGGGCAGG - Intronic
1017390530 6:153934205-153934227 ATTGAGTATTAGACAGGGGAAGG - Intergenic
1017534340 6:155330416-155330438 ATAGAGGAGATGACTGGAGAAGG + Intergenic
1017605579 6:156129093-156129115 AGAGAGAAGTGGGGTGGGGAAGG - Intergenic
1017650684 6:156578752-156578774 ATAGAAGAGAAGACTGTGGATGG - Intergenic
1017741165 6:157408011-157408033 ATATAGAAGTAGACTCAAGAAGG + Intronic
1017931952 6:158963490-158963512 AAAGAGAAAGAGACTGGGAAGGG - Intergenic
1020357471 7:7293008-7293030 ACAGAGAAGTATGCTGGGGCAGG - Intergenic
1020887889 7:13842262-13842284 CCAGAGAAGTGGACTGGGCAGGG - Intergenic
1021918844 7:25463261-25463283 ATAGCAAAGAAGACTGGAGATGG + Intergenic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1022970984 7:35517139-35517161 GTAGAGAAGGAGGCTAGGGATGG - Intergenic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG + Intergenic
1023919484 7:44616279-44616301 ATAAACAGGTTGACTGGGGAGGG - Intronic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024496495 7:50053305-50053327 TTAGAAAAGTAGACTGAGAATGG - Intronic
1026680388 7:72462338-72462360 ATAGAGAAATAAGCTGGGCATGG - Intergenic
1027702577 7:81486618-81486640 ATAGTGAACTAGACTTGGGCTGG - Intergenic
1028810036 7:95075538-95075560 ATGGAGAGGTAGGCTGGGCATGG + Intronic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029379727 7:100205150-100205172 ATAGAGATGTGGATTAGGGAAGG + Intronic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1029732005 7:102444648-102444670 AAAAAGAAGAAGCCTGGGGAAGG - Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1033855142 7:145552181-145552203 ATAGAGGCTTAGACTGGGGCTGG - Intergenic
1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG + Intronic
1036726422 8:11224787-11224809 CCAGAGCAGTAGGCTGGGGATGG - Intergenic
1037512775 8:19600368-19600390 ATAGAGAAGTAGGCTGGGTGCGG - Intronic
1038069274 8:23995440-23995462 ATTGAGAAGTGCAGTGGGGAAGG + Intergenic
1038454577 8:27664405-27664427 ATAGAAAAGTAATCTGAGGATGG + Intronic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1038786233 8:30619228-30619250 CTATTGAAGTAGACTGGGCACGG - Intronic
1038846935 8:31238730-31238752 CTAGAGAAGTAGATTGGGATTGG + Intergenic
1039735884 8:40332381-40332403 ATAGCTCAGGAGACTGGGGAAGG + Intergenic
1041065363 8:54077503-54077525 ATAAAAAAGTAGTCTGGGCACGG + Intronic
1041075754 8:54168227-54168249 ATACAGAAGTTAACTGGGCATGG + Intergenic
1042145965 8:65730635-65730657 ACAGAGAACTAGGCTGGGCATGG + Intronic
1043943596 8:86225015-86225037 ATAGGGAAGCAGACTGGACATGG - Intronic
1044041005 8:87368343-87368365 ATAAAAAAGTAGATTGGGCATGG + Intronic
1044143416 8:88683317-88683339 ATACAGAAATAGAATAGGGAAGG - Intergenic
1044637678 8:94342634-94342656 AAAGAAAAGTTGAGTGGGGAAGG + Intergenic
1046162974 8:110391289-110391311 ACAGAGAAATAGATTGGGAAGGG + Intergenic
1046732426 8:117739832-117739854 ATAAAAAAGTTCACTGGGGATGG - Intergenic
1047157162 8:122332282-122332304 AAAGAGAAGGAGAGTGGGGGTGG - Intergenic
1048010274 8:130449964-130449986 ATAGAGAAGTATGATGGTGAAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048433382 8:134391470-134391492 ATAGGGAAGTAGATGGAGGAAGG - Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049866843 8:144944503-144944525 ATAGAGAACTAGGCTGGGCATGG - Intronic
1050421116 9:5466214-5466236 ATAGGGAAGTAGAATATGGAAGG + Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051277784 9:15414037-15414059 ATATAGAATTAGACTGGGCGCGG - Intergenic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1052231741 9:26162377-26162399 ATAGAGAATTTGACTGAAGATGG + Intergenic
1053512535 9:38700873-38700895 TCAGAGAAGGAGGCTGGGGATGG - Intergenic
1055815009 9:80194689-80194711 AGAGATAAGTAGGGTGGGGAGGG + Intergenic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057494481 9:95550093-95550115 ATAGAGAGATTGTCTGGGGATGG + Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG + Intergenic
1059468466 9:114484907-114484929 AGTGAGAAATAGACTGGAGAGGG + Intronic
1059686310 9:116640201-116640223 ATTGAGAAATAGACTAGGGTTGG + Intronic
1059754869 9:117283173-117283195 ATAGCGAAGTAGAATGAGCATGG - Intronic
1060122891 9:121011947-121011969 ATAGAGTAGAAGGCTGGGAAGGG + Intronic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1061458880 9:130720273-130720295 ATAGAGAAGGGGACAGGGAATGG + Intronic
1185554817 X:1012977-1012999 AGAGAGAGGGATACTGGGGAGGG - Intergenic
1186421248 X:9428402-9428424 ATAGGAAAGTAGACTGGGCGCGG + Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187955019 X:24509005-24509027 AGAGACAAATAGGCTGGGGATGG - Intronic
1188355705 X:29188152-29188174 ACAGAGGAGTAGTCTGTGGAAGG - Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1189053454 X:37671746-37671768 TTAGATAAGTTGACTTGGGAGGG - Intronic
1189214494 X:39311417-39311439 AGAGAGAAGAACACAGGGGACGG + Intergenic
1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG + Intergenic
1190373107 X:49762148-49762170 AGAGAGAAGTGAACTGGAGATGG - Intergenic
1190942644 X:55057128-55057150 GTAGAGAAATAGACTGTGGTGGG + Intergenic
1190980132 X:55450040-55450062 ATAGAGGAGCACAGTGGGGAAGG + Intergenic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1192268241 X:69555324-69555346 ATAGAGAATGTGGCTGGGGATGG + Intergenic
1192272869 X:69599839-69599861 AGAGAGAAGTTGACTGGGGTTGG + Intergenic
1192753173 X:74016313-74016335 TTAGAGAAGTAGGCCGGGCATGG + Intergenic
1193832287 X:86304242-86304264 ACAGAGGAGTAGTCAGGGGAAGG - Intronic
1194946371 X:100073393-100073415 ATAGAGCAGAACATTGGGGAAGG + Intergenic
1195116743 X:101706961-101706983 ATAGAGTAGTAGCCAGGGGCGGG + Intergenic
1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG + Intergenic
1196431152 X:115627140-115627162 CTAGAAAAGTAGGCTGGGCACGG - Intronic
1196467074 X:115983413-115983435 CTAGAGAGGTAGACTGGCTAAGG - Intergenic
1198003699 X:132469099-132469121 ATAGAGAAGAATACCGTGGATGG + Intronic
1199125877 X:144119457-144119479 ATAGAGAAGTAGTGTGGGAAAGG - Intergenic
1200016142 X:153165038-153165060 GGAGAGAAGGAGAGTGGGGAGGG + Intergenic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic