ID: 951362678

View in Genome Browser
Species Human (GRCh38)
Location 3:21743129-21743151
Sequence AAGAGATACAACTGTAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951362676_951362678 2 Left 951362676 3:21743104-21743126 CCAAGGACACAGCACTACTGAAT 0: 1
1: 1
2: 3
3: 19
4: 228
Right 951362678 3:21743129-21743151 AAGAGATACAACTGTAAAGTAGG 0: 1
1: 0
2: 1
3: 20
4: 288
951362675_951362678 3 Left 951362675 3:21743103-21743125 CCCAAGGACACAGCACTACTGAA 0: 1
1: 0
2: 2
3: 38
4: 267
Right 951362678 3:21743129-21743151 AAGAGATACAACTGTAAAGTAGG 0: 1
1: 0
2: 1
3: 20
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951362678 Original CRISPR AAGAGATACAACTGTAAAGT AGG Intronic
900915318 1:5634362-5634384 AAGAGACACATATGTAAAGACGG - Intergenic
902144762 1:14389066-14389088 AAGACATACAAATGGCAAGTAGG + Intergenic
904658026 1:32063945-32063967 GATAGAGAGAACTGTAAAGTAGG - Intergenic
905342573 1:37289458-37289480 AAGAGGTAGGACTGGAAAGTTGG - Intergenic
906906379 1:49898330-49898352 AAGACATACAAATGACAAGTAGG + Intronic
907012333 1:50976048-50976070 ACAAGTTACAACTGTAAAGATGG + Intergenic
908282235 1:62552701-62552723 AAGACATGCATCTGTAAATTTGG - Intronic
908412712 1:63883296-63883318 AAGAGACACAACTTAAAGGTTGG - Intronic
909341569 1:74537954-74537976 CAGTGATACAACTATAAAATGGG - Intronic
909461816 1:75924934-75924956 AAAAGATACAAATTTAATGTAGG - Intronic
910003642 1:82367517-82367539 AAGAGACACAACTGAAAAATTGG - Intergenic
911159274 1:94668131-94668153 GAGAGATCCAAATGTAAACTTGG - Intergenic
912969098 1:114263771-114263793 AAGAGTTTAAACTGTAAAGTGGG + Intergenic
913357344 1:117937641-117937663 AAGAAATAACACTGTAAGGTGGG + Intronic
914837485 1:151219701-151219723 AAGAAACAAAACTGGAAAGTAGG + Intronic
915797335 1:158751347-158751369 AAGAGACAGAACTGGAAGGTAGG - Intergenic
916208035 1:162334286-162334308 AAGTGCTACAACTGGAAAGATGG + Intronic
917314872 1:173714191-173714213 AAGTGATACAAGTGTAAGGTGGG - Intergenic
918992419 1:191714851-191714873 TAGACATAGAACTTTAAAGTGGG + Intergenic
921490822 1:215773462-215773484 CAGAGAGACATCCGTAAAGTGGG - Intronic
922065922 1:222143113-222143135 AAGACATACAAATGGAAAATAGG + Intergenic
1063955650 10:11263305-11263327 AAAAAATCCAACTGTAAATTTGG - Intronic
1064451234 10:15443869-15443891 AACAAATAGAACTGTAAAGCAGG + Intergenic
1064658656 10:17582943-17582965 ACTAGATACAACTAGAAAGTAGG - Intergenic
1064749751 10:18515550-18515572 CAGATACAGAACTGTAAAGTTGG + Intronic
1065332172 10:24613697-24613719 AAGAGGAACTACTGTGAAGTAGG + Intronic
1065657934 10:27971534-27971556 AACAGATACAACTGCAAGGCTGG + Intronic
1066649595 10:37642177-37642199 AAGACATACAAATGGCAAGTCGG - Intergenic
1067137647 10:43625504-43625526 AAGAGGTATAACTATAAATTTGG + Intergenic
1068349843 10:55829252-55829274 AAGACATACAACTGAAATTTGGG + Intergenic
1069909954 10:71752900-71752922 AAGAGATACTTCTGTGCAGTAGG - Intronic
1071940304 10:90584062-90584084 AAGTGATAGAAATGTAAAATAGG + Intergenic
1072216895 10:93294862-93294884 AAGATATAAAACTGGAGAGTTGG + Intergenic
1072940708 10:99761088-99761110 AAGAAAAAAAAATGTAAAGTTGG + Intergenic
1074685721 10:115960830-115960852 CAGAAAAACATCTGTAAAGTTGG - Intergenic
1074804610 10:117036000-117036022 AAGAAATACAAATGTCAAATAGG + Intronic
1080193814 11:29583614-29583636 AAGAGATGCAAATGAAAACTAGG - Intergenic
1080226367 11:29965668-29965690 AATAGATGCAACTATAAAATTGG - Intergenic
1082223965 11:49678701-49678723 AAAAGATAAAACTGTATAATGGG + Intergenic
1082248684 11:49955807-49955829 AAGACATGGAGCTGTAAAGTAGG + Intergenic
1082864985 11:57890908-57890930 AATAAATACAATTTTAAAGTGGG - Intergenic
1085002264 11:73049714-73049736 AAGAGAGACACCTGAAGAGTTGG + Intronic
1086177289 11:83906682-83906704 ATGAGATTCATGTGTAAAGTGGG - Intronic
1086625075 11:88940461-88940483 AAAAGATAAAACTGTATAATGGG - Intronic
1087415147 11:97845815-97845837 AAGAAAAACAAATGAAAAGTAGG + Intergenic
1088055136 11:105565649-105565671 AAGACATACTACTGGAAAGAAGG + Intergenic
1089547160 11:119237495-119237517 AAGAGGTAAAACTATAAAATAGG - Intronic
1090773239 11:129940914-129940936 AGTAGATAGAACTATAAAGTTGG - Intronic
1094407754 12:30136471-30136493 AAGAGATACTACTGGAATGTAGG - Intergenic
1098656890 12:73042722-73042744 AAGAGATACACATGCAAATTTGG + Intergenic
1099231282 12:80028329-80028351 TTGATATACAACTGTAAAGTGGG + Intergenic
1099713053 12:86252762-86252784 AAGTCAAACAACTGTAAACTCGG + Intronic
1099731705 12:86512134-86512156 AAGACATACAAATGTCAAATAGG + Intronic
1100353195 12:93804166-93804188 AATACATACATCTGTAGAGTAGG + Intronic
1103243473 12:119434806-119434828 AAGAGATAAAATTGAAGAGTTGG + Intronic
1104365836 12:128175880-128175902 AAGGGATCCATGTGTAAAGTAGG + Intergenic
1104836253 12:131793763-131793785 AAGAGATCCTTCTGTCAAGTCGG - Intronic
1106965461 13:35060515-35060537 AAGAGATATACTTGTAAATTTGG + Intronic
1107211289 13:37858130-37858152 AAGACATACAAATGGAAAATAGG + Intronic
1109155860 13:58908008-58908030 AAGAGATACAATGACAAAGTAGG + Intergenic
1110082631 13:71335426-71335448 AAGAGTTACAACAGTACAGTAGG + Intergenic
1110898817 13:80793927-80793949 TATAGATACATTTGTAAAGTTGG + Intergenic
1111548238 13:89772938-89772960 AAGAGATAAACCTGTCAACTTGG + Intergenic
1111836529 13:93395333-93395355 AATGGACACAACTGTGAAGTTGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112648501 13:101363947-101363969 AAGACATACAAATGGCAAGTAGG + Intronic
1112999158 13:105612186-105612208 GAGAGATACGACTGTAATGAAGG + Intergenic
1113324987 13:109272200-109272222 GAGAGAGACATCTGAAAAGTGGG - Intergenic
1114074054 14:19143351-19143373 AAGAGAGATACCTGTAAATTTGG + Intergenic
1114088213 14:19256625-19256647 AAGAGAGATACCTGTAAATTTGG - Intergenic
1114137487 14:19868398-19868420 AAGGGTCACAACAGTAAAGTGGG + Intergenic
1114309395 14:21453010-21453032 AAGAAATACAACTGTCAGGCTGG + Intronic
1115530860 14:34325714-34325736 AAGAGATACAGCTGTGAACAAGG - Intronic
1115929976 14:38480166-38480188 AAGACATACAAATGGCAAGTAGG + Intergenic
1116788461 14:49313881-49313903 AAGTGATGCAAATGTAAATTTGG + Intergenic
1117931198 14:60842271-60842293 CAGAGAAAAAACTCTAAAGTGGG - Intronic
1118099549 14:62581192-62581214 CAGAGATCCAACTTTAAAGTGGG - Intergenic
1121646139 14:95517881-95517903 AAGAGATTAAATTGTAAAGCAGG + Exonic
1123485100 15:20686548-20686570 AAGAGAGATACCTGTAAATTTGG - Intergenic
1123537826 15:21255619-21255641 AAGAGAGATACCTGTAAATTTGG - Intergenic
1124672913 15:31657655-31657677 AAGAAATACATCTGGAAAGCTGG - Intronic
1125082579 15:35692762-35692784 AAGACATACAATTCAAAAGTTGG - Intergenic
1126610516 15:50524479-50524501 AAGACATACAAATGTCCAGTGGG + Intronic
1126658283 15:51004864-51004886 AGGAGATGTGACTGTAAAGTAGG + Exonic
1126755097 15:51918093-51918115 AGGAAATAGAATTGTAAAGTGGG + Intronic
1127404502 15:58627699-58627721 AAGAGAAACAACTGTTTTGTTGG - Exonic
1127795178 15:62431885-62431907 CAGGGATACAAATGTAGAGTGGG + Intronic
1130577132 15:85102853-85102875 AAAGAATACCACTGTAAAGTAGG + Intronic
1131314713 15:91324565-91324587 AAGACATACAATTGTCAAGCTGG - Intergenic
1131970574 15:97888560-97888582 AACAGAGTCAACTGGAAAGTTGG + Intergenic
1131982600 15:98009743-98009765 AAGAAATCCAATTGTAAAATAGG - Intergenic
1132021608 15:98367338-98367360 AGGATATAAAACTGTAAAGGGGG + Intergenic
1132076621 15:98826661-98826683 AAGAGATACAAATGTACTCTTGG - Intronic
1132247375 15:100308080-100308102 AAGTGAGACTTCTGTAAAGTGGG - Intronic
1137496939 16:48977277-48977299 AAGAGATAGAACTGGAAGTTTGG - Intergenic
1137835605 16:51589569-51589591 AAGAGCTACACCTGGAAAGAAGG - Intergenic
1138951414 16:61917779-61917801 AAGAAGTAAAGCTGTAAAGTTGG + Intronic
1139063898 16:63289944-63289966 CAGAGATACAAGTGTAGAGCTGG + Intergenic
1139223243 16:65206658-65206680 AAGAGATACACCTGCAAACACGG - Intergenic
1140135031 16:72198429-72198451 AAAAAATAGAACTGTAAAGCGGG - Intergenic
1141718285 16:85739830-85739852 AAGAGAAACAACTGTATTTTAGG + Intronic
1142942061 17:3387724-3387746 AAGAGATTCAACTGATAATTGGG - Intergenic
1143338189 17:6189200-6189222 AAGACATAGAAGTCTAAAGTTGG - Intergenic
1143547066 17:7603657-7603679 AACAGAGAAAACTGCAAAGTGGG + Intronic
1143969947 17:10788244-10788266 AGGAGATAAAACTATAAAGGAGG + Intergenic
1144531493 17:16043573-16043595 GAGAGAAAAAACTATAAAGTAGG + Intronic
1149265145 17:54920270-54920292 AAGGAGTACAACTGTAAAGAAGG + Intronic
1150164062 17:62924631-62924653 AAGAGCTGCAACTGTAAGCTAGG + Intergenic
1153054326 18:930743-930765 AATAGAGAAAAATGTAAAGTGGG - Intergenic
1154477270 18:14774695-14774717 AATTAATACAACTGTAAATTAGG + Intronic
1156228856 18:35134859-35134881 CAGAGATACAACAACAAAGTGGG - Intronic
1159274244 18:66194473-66194495 AAGAGACAAAAATGTAAATTGGG + Intergenic
1159699473 18:71607031-71607053 ATGTGATACAACTGGAAAGAAGG + Intergenic
1164026396 19:21357227-21357249 AAGACATCCAACTTTAAATTAGG - Intergenic
1164158084 19:22608419-22608441 AAGAGATACAACAGGAGTGTCGG - Intergenic
1164307952 19:24021520-24021542 AAGACATTCAACTTTAAATTAGG + Intergenic
1164664730 19:30020480-30020502 AAGCCACACAACTGTTAAGTAGG + Intergenic
925917622 2:8618016-8618038 AAGAGATACTAGGGTAAAGATGG + Intergenic
926846144 2:17141233-17141255 AAGAGTTCCAAGTGAAAAGTAGG + Intergenic
929039715 2:37732004-37732026 AAGATACAGAACTGTAAAGAAGG - Intronic
929592964 2:43158823-43158845 AAGGGAGAGAACTATAAAGTTGG - Intergenic
929882644 2:45850543-45850565 AAGACAGACAACTCTAAATTAGG - Intronic
930640818 2:53853017-53853039 ACAAGATTCAACTGAAAAGTTGG - Exonic
932832302 2:75002356-75002378 AAGAGAGACCACTGTCAAGTTGG - Intergenic
933026852 2:77270885-77270907 CAAAGACACAACTCTAAAGTGGG - Intronic
933394751 2:81716897-81716919 AAGAGATAAGACATTAAAGTTGG + Intergenic
936793667 2:116182414-116182436 AAGACATACAAATGGCAAGTGGG - Intergenic
938488230 2:131738399-131738421 AAGAGATATACCTGTAAGTTTGG + Intronic
938914898 2:135928260-135928282 CAGAGATACTACTGTGAAGCTGG + Intronic
939916533 2:148051021-148051043 AAGAGTTACTACTGTTAAGATGG - Intronic
941745686 2:169084614-169084636 AAGACATACAAGTGGAAAATAGG - Intronic
941964031 2:171283116-171283138 GTGAGATACAACTATAAATTTGG - Intergenic
941976515 2:171411113-171411135 AAGCTATACAACTGTACAGAGGG + Intronic
942565563 2:177262936-177262958 AAGACAAACAACTTTAAAGGGGG + Intronic
942975262 2:182009406-182009428 AAGAGATACAAATGGCAAATAGG - Intronic
943292246 2:186088746-186088768 AAATGATACAACTGTATAGAGGG + Intergenic
945358814 2:208870880-208870902 AAGAGATACAACTGAAAAGGTGG + Intergenic
945880289 2:215317822-215317844 AAGACATACAACTGAGAATTTGG - Intronic
946138510 2:217667975-217667997 AAGAGAAAGAAATGTAAAGTGGG + Intronic
946579362 2:221110324-221110346 AATAGATAATACTGAAAAGTTGG - Intergenic
946603770 2:221379526-221379548 CAAAGATACATCTATAAAGTCGG - Intergenic
946666591 2:222056472-222056494 AAAAGATACAACCAGAAAGTAGG + Intergenic
946867858 2:224058735-224058757 AAGAGATGCAGCTTCAAAGTGGG + Intergenic
946958764 2:224960651-224960673 AAGTGATAAAACTGGAAACTTGG + Intronic
947080487 2:226390453-226390475 AAGAGAGATAAATGGAAAGTAGG + Intergenic
947882529 2:233531088-233531110 AATAAATACAACTGGGAAGTTGG - Intronic
1168989525 20:2082373-2082395 ATGAGATACATATGTAAACTGGG - Intergenic
1171348571 20:24485461-24485483 AAGAGATAGAAAGGAAAAGTGGG + Intronic
1172344110 20:34183615-34183637 AAGAGTTACAGCTGTGAAATTGG - Intergenic
1173282422 20:41641100-41641122 AAGAGATCTAAATGTAAAGTGGG + Intergenic
1173621321 20:44438880-44438902 AAGAGGTGCAACTGTAAGCTGGG + Intergenic
1173679449 20:44867276-44867298 AAGGGATAAAACAGTAAAGATGG + Intergenic
1175213930 20:57379985-57380007 AAGAGATACTAGTGTAATCTTGG + Intergenic
1177765717 21:25454666-25454688 AAGAAATACAACTGCCAAGGGGG + Intergenic
1179000040 21:37449042-37449064 AAGAGGTACAAAAGTAAAGCAGG - Intronic
1179014154 21:37580892-37580914 AAGGGAAACAACTGGCAAGTTGG - Intergenic
1180289703 22:10836291-10836313 AAGAGAGATACCTGTAAATTTGG + Intergenic
1180492500 22:15865713-15865735 AAGAGAGATACCTGTAAATTTGG + Intergenic
1203291996 22_KI270736v1_random:3578-3600 AAGATACAGAACTGTAAAGAAGG - Intergenic
951211567 3:19981196-19981218 AAGTCAAACCACTGTAAAGTTGG - Intronic
951362678 3:21743129-21743151 AAGAGATACAACTGTAAAGTAGG + Intronic
951515346 3:23552621-23552643 AAGACAATCAACTGTAGAGTGGG - Intronic
951995932 3:28728781-28728803 AAGAGATACAAATATAAATCAGG - Intergenic
952030210 3:29132529-29132551 ATGAGATGGAACTGTAAAGTGGG + Intergenic
953287688 3:41628620-41628642 CAGAGAAACAAATGTAATGTGGG + Intronic
953729650 3:45436027-45436049 AAGAAATAAAACTCTAAACTTGG - Intronic
954981451 3:54749615-54749637 AAGAGATTTTACTTTAAAGTAGG - Intronic
955340911 3:58124353-58124375 CCGAGAGTCAACTGTAAAGTCGG - Exonic
955811069 3:62790243-62790265 CAGAGATACTACTATAAAGTTGG - Intronic
957106873 3:75900562-75900584 AAGAGATATAACTGTGAACTTGG - Intergenic
957147136 3:76439262-76439284 AACAGAAACAAATGTAAAATGGG + Intronic
957147147 3:76439383-76439405 AACAGAAACAAATGTAAAATGGG + Intronic
959784885 3:110284165-110284187 AATAGATACAACACAAAAGTAGG - Intergenic
959799783 3:110479019-110479041 ATGAAATACCACTGAAAAGTAGG + Intergenic
960019032 3:112928692-112928714 AAGAGATAAAAATGAAGAGTGGG + Intronic
960204500 3:114878919-114878941 AAGCTATACAAATGTAAAGCAGG + Intronic
960883240 3:122367187-122367209 AAGAGAATGAACTGTAAAGCAGG + Intronic
961398782 3:126618767-126618789 TAAAGAGACAACTGTAAAATGGG + Intronic
961611032 3:128139412-128139434 AAGACATACAAATGGCAAGTAGG + Intronic
962181469 3:133210233-133210255 AAGTGATTCTACTGTATAGTTGG - Intronic
963569093 3:146969590-146969612 AAGAAACACAACTGCAAATTTGG + Intergenic
964991731 3:162820992-162821014 AAGGGAGAAACCTGTAAAGTGGG + Intergenic
966087000 3:176080169-176080191 AAGAGATACAACCTTAAAAAAGG - Intergenic
966901014 3:184484854-184484876 AAGAAATACATTTATAAAGTTGG + Intronic
967404444 3:189100049-189100071 AAGAGAAACAGCTGAAAAGAAGG + Intronic
968784708 4:2611618-2611640 AAGAGATACAAATGGAAAATAGG - Intronic
971638996 4:29104477-29104499 AAGAGATGCAACTTTAGAATAGG + Intergenic
971653617 4:29311798-29311820 AAGACATGGAACTGAAAAGTGGG - Intergenic
972769811 4:42186700-42186722 AAGAGATACAACTAAAAAACTGG - Intergenic
973716751 4:53684575-53684597 AAGAGATACATCAGGGAAGTGGG + Intronic
974617083 4:64303580-64303602 TAGATATTCATCTGTAAAGTGGG + Intronic
974816382 4:67010022-67010044 AAGAAAAAGAACTGTAGAGTTGG - Intergenic
974892829 4:67902185-67902207 AAGACATACAAGTGTCAAGCAGG - Intergenic
975081295 4:70283659-70283681 AAGAGATACAAATGTCAAACAGG + Intergenic
975222269 4:71826369-71826391 AAAATATAAAACTATAAAGTTGG - Intergenic
975234969 4:71983243-71983265 GAGAGATACAAATCTACAGTTGG - Intergenic
976385141 4:84448339-84448361 TAGATATACAACTGTGAAATAGG - Intergenic
978673515 4:111280665-111280687 AGGAAATACAACTTTAAAGATGG - Intergenic
980263515 4:130485132-130485154 AAGAGATAAGACTATAAATTGGG + Intergenic
981570508 4:146146091-146146113 AAGAGAAATAATTGCAAAGTGGG - Intergenic
982551808 4:156811169-156811191 AAGAGACACAACTGAAAATGAGG + Intronic
982952884 4:161722449-161722471 ATGAGATTTATCTGTAAAGTAGG - Intronic
983839980 4:172445557-172445579 AATAGATGTAACTGAAAAGTTGG + Intronic
984243752 4:177249584-177249606 AAGAGATGCCACTGTAGTGTTGG - Intergenic
984785575 4:183564598-183564620 AAGAAATAAAACTGACAAGTGGG - Intergenic
985442804 4:189996680-189996702 AAGACATACAAATGTCAAGCAGG - Intergenic
985994794 5:3591922-3591944 AAGAAATAAAATTGTAAATTAGG + Intergenic
987466807 5:18281545-18281567 AAGGGAAACAACAGTAAAGGAGG + Intergenic
987631293 5:20476459-20476481 AAGAAATTCAACTCTAAACTTGG - Intronic
987679700 5:21118872-21118894 AAGAGAAAGAACTGTAAAAGAGG - Intergenic
987718884 5:21609519-21609541 AAGACATACTACTGTTAAGATGG - Intergenic
991468338 5:66938831-66938853 AACAGATACAACTGGCAGGTTGG + Intronic
992984394 5:82212680-82212702 AACAGATACAACTTTAATGAAGG + Intronic
994741418 5:103624351-103624373 AAAACAAACAACTGTAAAGCTGG + Intergenic
996221927 5:120943624-120943646 AAGAGCTTCAACTGTAAAATGGG + Intergenic
996292671 5:121871804-121871826 AAGTCATACAACTGATAAGTGGG - Intergenic
998798975 5:145848861-145848883 AGGAGAGACACCTCTAAAGTTGG - Intergenic
999835745 5:155369118-155369140 CAGAGATCCAACTGAAAGGTTGG - Intergenic
1000271797 5:159692293-159692315 AAGACATACAAATGGAAAATAGG + Intergenic
1000997633 5:167974478-167974500 AAGAGATACATACTTAAAGTAGG + Intronic
1001881870 5:175251535-175251557 AAGAGAGAGAACTGTAGAGGGGG - Intergenic
1003043518 6:2711817-2711839 AAGGTATATAACTTTAAAGTAGG + Intronic
1003160999 6:3634076-3634098 AAGAGAAACAAATACAAAGTGGG + Intergenic
1003369890 6:5513955-5513977 AAGAGATACAACAGTGCATTTGG - Intronic
1006479427 6:34279933-34279955 AAGGGATACATTAGTAAAGTAGG + Exonic
1006524229 6:34590078-34590100 AAGAGATTCAGGTGAAAAGTTGG - Exonic
1007124630 6:39415417-39415439 AGGAGACACACCTGTAAGGTGGG - Intronic
1007746971 6:44049074-44049096 GGGAGATAAAACTGGAAAGTAGG - Intergenic
1007751589 6:44074800-44074822 CAGAGAAACAAGTGAAAAGTGGG + Intergenic
1009878078 6:69531349-69531371 GAGACATACAATTGTGAAGTTGG + Intergenic
1009900281 6:69800899-69800921 AAGAGATCCAACTTTAAATAAGG - Intergenic
1010184788 6:73131325-73131347 AAGAGATATATCTTGAAAGTTGG + Intronic
1010790551 6:80059469-80059491 AAGAGATACAACGTGAAACTTGG + Intergenic
1011713714 6:90081984-90082006 AAGAGATGCATCTTTAAAGGGGG + Intronic
1011717956 6:90126880-90126902 AAAAGATAAAACTGCAAAATGGG + Intronic
1011873202 6:91923231-91923253 AAGACATACAAATGTCAAATGGG + Intergenic
1012018740 6:93888675-93888697 AAGAAATACAACTGAACAGCTGG - Intergenic
1013098338 6:106966553-106966575 AAGAGACATAATTGGAAAGTTGG + Intergenic
1013279085 6:108618059-108618081 AAAAGACACACCTGTACAGTTGG - Intronic
1013700502 6:112763684-112763706 AAGAGATGAAACTGTTAATTAGG - Intergenic
1015658663 6:135548070-135548092 AAGAGAGACACCTGAAGAGTTGG + Intergenic
1016542853 6:145185701-145185723 AAGATATACAAATGGAAAATGGG + Intergenic
1017320425 6:153085897-153085919 AAGAAAAACAACTGTAGAGGGGG + Intronic
1020723536 7:11780093-11780115 AAGATATACATCTGTAAACCAGG - Intronic
1020845999 7:13284514-13284536 AAGAAATACAACGGTAAAATTGG + Intergenic
1023536314 7:41216179-41216201 AAGAGAAAAAAGTGTAAAGAAGG - Intergenic
1023577692 7:41646969-41646991 AACAGCAGCAACTGTAAAGTAGG - Intergenic
1026065675 7:67070591-67070613 AAGAGATACAAATGATAAGAAGG - Intronic
1026711202 7:72741270-72741292 AAGAGATACAAATGATAAGAAGG + Intronic
1027392220 7:77716100-77716122 AAGAAATAAAAGTATAAAGTGGG - Intronic
1027451578 7:78337428-78337450 AAGAGAAACAAGGGTAGAGTTGG - Intronic
1028033338 7:85947266-85947288 AAGAGATACAACTAGAAATTAGG - Intergenic
1029288301 7:99481884-99481906 AAGAGTTACTTCTGGAAAGTAGG - Intronic
1030717812 7:112831289-112831311 AAGATAGATAACTCTAAAGTAGG - Intronic
1030917016 7:115327987-115328009 AAGTGATAGTGCTGTAAAGTGGG + Intergenic
1031315417 7:120252047-120252069 AACACATAAAACTGTAATGTTGG - Intergenic
1031354557 7:120775904-120775926 AGGAGAAACAGCTGTAAAGGAGG - Intergenic
1031523296 7:122793101-122793123 AAGAGAAACAACAGTAAAGGAGG - Intronic
1031594798 7:123637628-123637650 AAGATATATAACTGTAAGATTGG - Exonic
1031801890 7:126257236-126257258 AAAAGAAGGAACTGTAAAGTTGG - Intergenic
1032919418 7:136528278-136528300 AAGAGAAACAAATGGAAAGAAGG + Intergenic
1033332792 7:140429988-140430010 TAGAGATAAAGCTGTAAGGTTGG + Intergenic
1033853826 7:145532677-145532699 AAAAGATAAAACTATAAAGTTGG + Intergenic
1035521357 8:277280-277302 AAGAAATAAAACTAGAAAGTGGG - Intergenic
1037665598 8:20967071-20967093 AAGAGCTTCATCTGTAAAATGGG - Intergenic
1038410702 8:27356853-27356875 AAGAGATGAAACTGTAGAGATGG + Intronic
1039130105 8:34254008-34254030 AAGAGTTACAACTGTTAAGGAGG - Intergenic
1040465319 8:47689527-47689549 ATGCCATACAACTGGAAAGTAGG + Intronic
1040789564 8:51210108-51210130 AAGATATACAACTATAAATGTGG - Intergenic
1041596763 8:59664065-59664087 AATATATACAATTATAAAGTGGG + Intergenic
1041820629 8:62028507-62028529 AATTGATACAGCTGTAAAGGAGG - Intergenic
1042486243 8:69349199-69349221 AAGAGATACAAATGCATAGATGG - Intergenic
1042574766 8:70205690-70205712 AAGAGATGCAAGTGCAAAGGAGG + Intronic
1044028580 8:87205674-87205696 AAGAGATGCAACTTTACAATAGG + Intronic
1045669688 8:104536187-104536209 AAGAGATAGAATGGGAAAGTGGG - Intronic
1046481082 8:114819442-114819464 AAAAGTTACAACTGAAAATTCGG - Intergenic
1048186237 8:132243660-132243682 AAGACACACAGCTGTTAAGTTGG - Intronic
1048604131 8:135949955-135949977 AAGTGATACAAATATAAAGCTGG - Intergenic
1049490990 8:142902046-142902068 AAGCAACACAACTGTAAAATTGG + Intronic
1051146254 9:14030729-14030751 AAGCCATACAACTGTAAACCTGG + Intergenic
1051758018 9:20426528-20426550 AAGAGATGCAACTGAACAATGGG + Intronic
1051783820 9:20720622-20720644 AAGAAAAACAACTGGCAAGTAGG - Intronic
1052262759 9:26537061-26537083 AGGAGATACACCAGAAAAGTTGG + Intergenic
1052438863 9:28466963-28466985 ATGAGATACAAAGGCAAAGTGGG + Intronic
1053247675 9:36548328-36548350 AAGATACACAACTGTCGAGTAGG + Intergenic
1055113240 9:72580252-72580274 AAGAGATAAGACTATATAGTAGG - Intronic
1055261661 9:74443608-74443630 AATAGATACAACTGTAATTGAGG - Intergenic
1055564925 9:77558862-77558884 AAGAGATACAACTCTGAATCAGG - Intronic
1057972728 9:99572992-99573014 AAGAGATACCACTGTTTATTTGG - Intergenic
1059826375 9:118033842-118033864 AAGAGAGACTACTGTAATATGGG - Intergenic
1185743123 X:2549921-2549943 GAGAGAGACATCTGAAAAGTAGG + Intergenic
1188428906 X:30082941-30082963 AAGACATACAAATGGAAAGCAGG - Intergenic
1188988123 X:36786134-36786156 CAGTGATATAACTGGAAAGTGGG + Intergenic
1191130351 X:57001678-57001700 AAGAGCTAAAACTGTAAAACTGG - Intergenic
1192062815 X:67847205-67847227 AAGACATACAAATGTCAAGCAGG + Intergenic
1192257222 X:69471968-69471990 CAGAGATAGAACTGGAAAATGGG - Intergenic
1192662679 X:73058534-73058556 AAGACATACAAATGGAAAATAGG + Intergenic
1192908099 X:75573099-75573121 AAGACATACAAATGGCAAGTAGG - Intergenic
1193122194 X:77835289-77835311 AAGACATACAAATGGCAAGTAGG + Intronic
1193167320 X:78295669-78295691 AAGACATACAAATGTTAAATAGG - Intronic
1194112085 X:89847027-89847049 AAGGAATACAATTGTAAAATAGG - Intergenic
1194157473 X:90409946-90409968 AAGACATACAAATGGAAAGCAGG - Intergenic
1194444491 X:93971283-93971305 AAGAGATAAAAAAATAAAGTGGG - Intergenic
1194903603 X:99544985-99545007 AAGACATACAAATGGAAAATAGG - Intergenic
1195777895 X:108427821-108427843 AAGAGATAGCACAGTAGAGTGGG + Intronic
1196406122 X:115364530-115364552 AGTAGACCCAACTGTAAAGTGGG + Intergenic
1200503805 Y:3986927-3986949 AAGACATACAAATGGAAAGCAGG - Intergenic
1200755567 Y:6986968-6986990 ATGAGATAACACTATAAAGTGGG - Intronic
1200852805 Y:7903196-7903218 AAAAGAAAGAACTGCAAAGTTGG + Intergenic
1201894943 Y:18983172-18983194 AAAAGATACAACTATATAGGTGG + Intergenic