ID: 951363859

View in Genome Browser
Species Human (GRCh38)
Location 3:21756660-21756682
Sequence GAGCAAAAGCACAAGTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951363859 Original CRISPR GAGCAAAAGCACAAGTATAT GGG Intronic
900039714 1:448492-448514 CAACAAAAGCAAAAATATATGGG + Intergenic
900061146 1:683468-683490 CAACAAAAGCAAAAATATATGGG + Intergenic
907079111 1:51604998-51605020 GGGCAAAAGCATAAGTGAATGGG - Intronic
909187781 1:72511052-72511074 GAGCAACAGCACTAGTAGAATGG - Intergenic
909941905 1:81621048-81621070 TAGCAAAAGCACCATGATATGGG - Intronic
911852584 1:102838040-102838062 GAGTAAGAGCAGAAGTATTTTGG - Intergenic
912678738 1:111713707-111713729 AAGAAAAAGCACCACTATATAGG - Exonic
913558693 1:119996568-119996590 AAGCAAAAGCACAAGCACATAGG + Intronic
913566060 1:120073707-120073729 GAGATAAAGCACAGGGATATGGG + Intergenic
913632073 1:120719846-120719868 GAGATAAAGCACAGGGATATGGG - Intergenic
914286648 1:146233066-146233088 GAGATAAAGCACAGGGATATGGG + Intergenic
914547679 1:148683807-148683829 GAGATAAAGCACAGGGATATGGG + Intergenic
914618834 1:149386547-149386569 GAGATAAAGCACAGGGATATGGG - Intergenic
917004905 1:170403627-170403649 GACCAAAAGCAGAAGCAGATAGG + Intergenic
918615415 1:186538893-186538915 GAGAAAAAGAAAAATTATATGGG + Intergenic
919282996 1:195516958-195516980 GAGCAAAAGTACAACTCTTTAGG - Intergenic
920497381 1:206464946-206464968 CACCAACAGCACAAGCATATTGG - Intergenic
1063993827 10:11597079-11597101 GTTCACAAGCAGAAGTATATAGG + Intronic
1065059519 10:21884731-21884753 GAGCAATAGCAGAAGTAATTTGG + Intronic
1066363018 10:34749115-34749137 AAATAAAAGCAAAAGTATATGGG - Intronic
1069092204 10:64213731-64213753 GAGCTAAATATCAAGTATATTGG + Intergenic
1069147278 10:64909908-64909930 GAGCAAAAGCTAAAATATTTTGG + Intergenic
1070243836 10:74711242-74711264 GAGAAAAAGCAAAATTATCTGGG + Intergenic
1071886661 10:89958720-89958742 ATGCAAGAGCACAAGAATATGGG - Intergenic
1073988224 10:109233632-109233654 GAACACACACACAAGTATATAGG - Intergenic
1076034497 10:127187796-127187818 AAGCAAAAGCAAAAGCATATTGG + Intronic
1076965937 11:84405-84427 CAACAAAAGCAAAAATATATGGG + Intergenic
1078706762 11:13751093-13751115 AAACAAAAAAACAAGTATATAGG + Intergenic
1079609984 11:22420422-22420444 GAGCAAAAGCTGAAGTTTATTGG - Intergenic
1080792750 11:35536298-35536320 GAGCCAAATCACAGGTAAATTGG - Intergenic
1081149685 11:39611903-39611925 GAGCAAAAGAAAAAATAAATTGG + Intergenic
1081483139 11:43507268-43507290 GAGATAAAGCACAAGTAGGTAGG + Intergenic
1081780591 11:45708652-45708674 GAGCAAGAGCAAAAGCATTTAGG + Intergenic
1088992929 11:114970317-114970339 GAGCAAAAGAAGGAGAATATTGG - Intergenic
1091537064 12:1421216-1421238 GAGTAAAAGCACAGGTAGATGGG - Intronic
1091937018 12:4442408-4442430 GAGAAAATGCACAAATATAGAGG - Intronic
1093010231 12:14099754-14099776 GACCAAAGTCACAAATATATAGG + Intergenic
1093476839 12:19565424-19565446 GAAGAAAAGCACAAGAATTTGGG - Intronic
1096897049 12:54832121-54832143 GAGCAAAAACTAAAGGATATAGG + Intronic
1097102141 12:56597263-56597285 GAAGAAAAGCACAACTAAATGGG + Exonic
1098082727 12:66807067-66807089 GAGGGAAAGCATGAGTATATGGG + Intergenic
1098779583 12:74669768-74669790 TAGCAAAAGCACAAGTGCAGTGG + Intergenic
1098912845 12:76227544-76227566 GAACAAAAGCATATGAATATTGG - Intergenic
1099259680 12:80362059-80362081 GAGGAAAAGCTCCAGGATATTGG - Intronic
1100462412 12:94813909-94813931 AAGCAAAAGTACAATAATATTGG - Intergenic
1103999501 12:124851517-124851539 GAGCAAAATCACAAGCAGAATGG + Intronic
1104380003 12:128299013-128299035 GAGCAACAGCACATGTGTGTGGG + Intronic
1104741071 12:131174695-131174717 CAACAAAAGAACAAATATATGGG + Intergenic
1108781781 13:53845367-53845389 GAGCAAAAACAAAAGTATTCTGG - Intergenic
1108941173 13:55955245-55955267 GAGCAAATGCATAGGTAAATTGG - Intergenic
1110259414 13:73468263-73468285 GAGAAAAAGCCCAAGCAAATGGG + Intergenic
1113210674 13:107976298-107976320 GAGCAAAAATAAAAGCATATGGG + Intergenic
1114857891 14:26473491-26473513 GAGCAAAAGCATAACTTTAAAGG + Intronic
1115803486 14:37023449-37023471 GACCAAAAGTACAAGGAAATTGG - Intronic
1116182794 14:41556584-41556606 TAGCAAAAGCACAGGGAAATTGG - Intergenic
1116719504 14:48476654-48476676 GAGCTAAATCACAATTCTATAGG + Intergenic
1120286834 14:82513726-82513748 AAGAAATAGCACAAATATATAGG + Intergenic
1124556372 15:30729490-30729512 GAGCAAAAGCAAAGGTCTGTTGG + Intronic
1124674901 15:31676280-31676302 GAGCAAAAGCAAAGGTCTGTTGG - Intronic
1124813648 15:32966837-32966859 GAGCAAAAGTGCAATTATTTGGG - Intronic
1124878075 15:33614955-33614977 GAGAAATAGCAATAGTATATAGG - Intronic
1129011496 15:72422267-72422289 GAGCAAATGTTAAAGTATATAGG + Intergenic
1129066020 15:72904595-72904617 GAGCAAAAGAACAAGAAAAGAGG + Intergenic
1130870032 15:87963271-87963293 GAAAAACAGCACAAGTATTTAGG - Intronic
1132442194 15:101879120-101879142 CAACAAAAGCAAAAATATATGGG - Intergenic
1133828011 16:9296143-9296165 GTACAAAAGCGCAAATATATCGG + Intergenic
1139831293 16:69800457-69800479 AACCAAAAGCAAAAGTATATTGG - Intronic
1142540257 17:653321-653343 GAGCACTTCCACAAGTATATGGG - Exonic
1143072284 17:4306636-4306658 AAGCAAAACCACAAATATTTTGG - Intronic
1143174253 17:4947587-4947609 CAGCATAAGCGAAAGTATATTGG - Intronic
1146244671 17:31269320-31269342 GGGCAAGAGCATAAGTATATTGG - Intronic
1146848673 17:36202625-36202647 GAGCTTTAGCAAAAGTATATTGG - Intronic
1148690036 17:49521794-49521816 GAGCAAAAGCACAAGAATGGGGG + Intergenic
1153417351 18:4861879-4861901 GAACAAAACCACTAGTATGTTGG - Intergenic
1153558111 18:6339036-6339058 GAACAAACCCACAAATATATTGG + Intronic
1154469200 18:14682133-14682155 GAACTAAAGCAAAAGTATTTTGG + Intergenic
1160642741 19:154035-154057 CAACAAAAGCAAAAATATATGGG + Intergenic
1164583005 19:29446555-29446577 GTGAAACAGAACAAGTATATGGG - Intergenic
925872491 2:8283337-8283359 TAGCAAAATCACAACTATATGGG - Intergenic
928739714 2:34336540-34336562 GAGCAAATGAACAACCATATGGG + Intergenic
928916088 2:36472476-36472498 TAGCAAAAGCACAAGGATCAAGG - Intronic
930693903 2:54391649-54391671 AATCAAAACCACAAGTTTATGGG + Intergenic
930920771 2:56750870-56750892 CAGCAAAAGCACAAAGATACAGG - Intergenic
932103183 2:68919587-68919609 GGGGAAAAATACAAGTATATGGG + Intergenic
933315776 2:80713227-80713249 GACCACAAGCTAAAGTATATAGG - Intergenic
934524868 2:95045537-95045559 CAGCACAAACACAGGTATATTGG - Intronic
936637522 2:114276284-114276306 TAGCAAAAGCAAAAATATTTTGG - Intergenic
937071335 2:119065993-119066015 GAGCAATAGCAGATGAATATGGG - Intergenic
938323827 2:130383977-130383999 GAAAAAAAGCCCATGTATATTGG + Intergenic
939608218 2:144278211-144278233 GAGCAAAAGCAAAAGACTGTAGG - Intronic
940205847 2:151200904-151200926 GAAGAAAAGCACAAGAATTTGGG + Intergenic
940421557 2:153484949-153484971 CAGTAAAAACACAAGTTTATAGG - Intergenic
940460441 2:153957823-153957845 AAGCAAAGGAAAAAGTATATGGG - Intronic
941637622 2:167952411-167952433 GAGCAAAAGCAAAAATAAAATGG - Intergenic
941966105 2:171302825-171302847 GGGTAAAAACAAAAGTATATAGG + Intergenic
942937975 2:181581536-181581558 GATCAAAAGCAATATTATATAGG + Intronic
944890576 2:204113234-204113256 GAGCAAAAGCACAGGTACAAAGG - Intergenic
945535365 2:211010995-211011017 GAGGAAAAGCAGATGTAAATTGG - Intergenic
945563033 2:211361953-211361975 GAGCAAAAACATAAGAATAATGG - Intergenic
947076850 2:226354471-226354493 GAACAAATGCACAAGGATATTGG + Intergenic
948293228 2:236842787-236842809 GGGCAAATGCACAAGTACAGAGG - Intergenic
1172826354 20:37790385-37790407 GTGCAAAAGCAAAATTATAATGG + Intronic
1173313368 20:41920708-41920730 GAGCAAGAGACAAAGTATATAGG + Intergenic
1174219625 20:48943503-48943525 GAGCAAAAGTACAAGAATGGTGG - Intronic
1174666863 20:52266251-52266273 GAGAAAAAGCACAAGATTAAAGG - Intergenic
1174753328 20:53133869-53133891 GACCAATAGAACAAGTAGATTGG + Intronic
1176994726 21:15542276-15542298 GAGCAAGAGGACAAGTACATTGG + Intergenic
1177674489 21:24278929-24278951 GAGCAAAAGGAGAAGTATTCTGG + Intergenic
1178241469 21:30906352-30906374 GAACAAAAGCACAAGTAAATTGG - Intergenic
1181042696 22:20199840-20199862 GAACAGACACACAAGTATATGGG - Intergenic
1183796991 22:40127356-40127378 TAGCTAAAGCAGAAGCATATAGG + Intronic
951240718 3:20283222-20283244 GGGCAAAAGCAGAATTATAACGG - Intergenic
951363859 3:21756660-21756682 GAGCAAAAGCACAAGTATATGGG + Intronic
952550776 3:34474004-34474026 GAGAAAAAGCAAAAGGATATTGG - Intergenic
953636098 3:44666385-44666407 GTGCACACGCACACGTATATGGG - Intergenic
955101497 3:55854333-55854355 AAGCAAAAACTCAAGTTTATGGG - Intronic
956373694 3:68591317-68591339 AAGCAAAACCACAGGTATGTAGG - Intergenic
956772799 3:72540708-72540730 GAACAAAAGCAAAAATATAGGGG + Intergenic
957436136 3:80178666-80178688 GTGTAAAAGTACAATTATATTGG - Intergenic
960205217 3:114888473-114888495 GATCAATAGCAAAAGTATACTGG + Intronic
963490395 3:145993097-145993119 GAGCAGAAGCACCATTATATTGG + Intergenic
963617093 3:147554811-147554833 GAGCATAAGGACAAATAAATAGG + Intergenic
965811538 3:172595931-172595953 GAGCAAGAGGACATGTGTATTGG + Intergenic
966283862 3:178269853-178269875 GAGCAAATAGACAAGTATTTGGG - Intergenic
966661751 3:182422179-182422201 GTGAAAAAGCACAATGATATAGG - Intergenic
967236887 3:187393683-187393705 GAGCAACACCACAATTAGATGGG - Intergenic
972193580 4:36625771-36625793 GAGCAAAAGAGAATGTATATTGG + Intergenic
972327929 4:38035479-38035501 GAGTAAAAGCACTAGTTTAGTGG + Intronic
975737493 4:77395404-77395426 GAGTAAGAGCAGAAGTATTTTGG + Intronic
975879326 4:78884515-78884537 GACCAAAAGTATAAGTATTTAGG - Intronic
976027895 4:80713135-80713157 AAGCAGAAGCAAAAGTATGTAGG + Intronic
977875185 4:102141270-102141292 GAGGATAAGCACAAGTGTAACGG - Intergenic
979479356 4:121198246-121198268 GAGAAAATGCACAAATTTATAGG + Intronic
984244174 4:177254683-177254705 GAGCCTAAGCACAAGTTTACAGG - Intergenic
984461504 4:180042752-180042774 GAGCTAAAGCACTAGTAAGTAGG - Intergenic
986184814 5:5425327-5425349 GAGCAAGATCACAAGTATTTAGG + Intronic
986574789 5:9200448-9200470 GAGCAAATGCACATTTATCTTGG + Intronic
987160349 5:15135062-15135084 CAGCAAAAGCCCAAGGACATAGG - Intergenic
988435423 5:31168746-31168768 GAGCAACAGCACAACTCTAGAGG - Intergenic
988554832 5:32227090-32227112 AATAAAAAGCACAAGTATACAGG + Exonic
990739272 5:58895601-58895623 GAGCTAATGCACATGTATGTTGG + Intergenic
992682641 5:79168147-79168169 GAGCAACAGCCCCAGGATATTGG + Intronic
993029516 5:82689150-82689172 GGGCAAAAGCACAAGCAGAAAGG - Intergenic
993164399 5:84333474-84333496 GATCAAAAGCACAAACATAATGG + Intronic
994770242 5:103972890-103972912 TAACAAAAGCAAAAGTAAATGGG - Intergenic
994962261 5:106620853-106620875 GAACAAAAGCACCAGAAAATAGG + Intergenic
999154114 5:149445920-149445942 GAGTAAAAGCACAAGGCTCTAGG + Intergenic
999160651 5:149494295-149494317 GAGGATAAGCACAACCATATGGG + Intronic
999947956 5:156617839-156617861 GAGGAAAAGCACAGGAACATGGG - Intronic
999954252 5:156683261-156683283 CAACAAAAGCAGAAGTAAATGGG - Intronic
1000139221 5:158385218-158385240 GGCCAAAAGCACCAGTGTATGGG + Intergenic
1000855574 5:166394089-166394111 GAGAATAAGCAAAAGTATAAAGG - Intergenic
1000920019 5:167127260-167127282 GAGCAAAAGCAATTGTCTATAGG + Intergenic
1001272300 5:170322866-170322888 AACCAAAAGGACATGTATATAGG - Intergenic
1002734133 5:181370451-181370473 CAACAAAAGCAAAAATATATGGG - Intergenic
1002750408 6:103675-103697 CAACAAAAGCAAAAATATATGGG + Intergenic
1006598470 6:35210531-35210553 GAACAAAAGCCCAAGTGTTTGGG - Intergenic
1009571288 6:65388901-65388923 AAGAAAAAGAACAAATATATTGG - Intronic
1012004611 6:93696926-93696948 GAGCAAAAACTGAAGTATTTTGG + Intergenic
1012015482 6:93844191-93844213 AAGCAAAATTACAAGGATATGGG - Intergenic
1016756628 6:147694398-147694420 GAGCAAAATCATAATTATTTGGG - Intronic
1018601169 6:165542916-165542938 CAGTAAAAGAACAAGTATATTGG - Intronic
1018877182 6:167832751-167832773 GAGCAAAAGCACAAAAATTTTGG - Intronic
1019238381 6:170642765-170642787 CAACAAAAGCAAAAATATATGGG - Intergenic
1026449612 7:70516212-70516234 GAGAAAAAGCACATCTTTATAGG - Intronic
1026638480 7:72104631-72104653 GAGAAAAAGCACAGGTATCTTGG + Intronic
1027516964 7:79154448-79154470 CAGTAAAAGCACAAATAAATTGG + Intronic
1030453489 7:109743632-109743654 GAGAAAAAGCACCATTATACTGG + Intergenic
1031475496 7:122216191-122216213 GATCTAGAGCACAAGTAGATAGG + Intergenic
1034786317 7:153929029-153929051 GAGGTAAAGCCCAAGTATGTAGG - Intronic
1035509388 8:163842-163864 CAACAAAAGCAAAAATATATGGG + Intergenic
1035813603 8:2514269-2514291 GAGCAAAAACACAAGTAATTTGG - Intergenic
1037575135 8:20195547-20195569 GAGAAAATGCACATGTGTATCGG - Intergenic
1037920404 8:22801667-22801689 TTGCAAAAGCACACGTAGATGGG + Intronic
1038880845 8:31609621-31609643 TATTGAAAGCACAAGTATATTGG + Intergenic
1039043569 8:33430230-33430252 GAGCAAAAGCCAAAGTAACTTGG + Intronic
1040645754 8:49394715-49394737 GAACAAAAGAACAAGTTTACTGG + Intergenic
1041118728 8:54565536-54565558 GAGCAAATGGACCAGTATAAAGG - Intergenic
1042053325 8:64734835-64734857 AAACAAAAGCATAAGTATACTGG + Intronic
1048621690 8:136140625-136140647 GACCAAAAGCACAAGTGTCCAGG - Intergenic
1048916617 8:139190188-139190210 GAGCAAAAGAACAAGTATGGGGG + Intergenic
1053571154 9:39309153-39309175 GAGCAGAAGCAAATCTATATTGG + Intergenic
1053837043 9:42149758-42149780 GAGCAGAAGCAAATCTATATTGG + Intergenic
1054092720 9:60867856-60867878 GAGCAGAAGCAAATCTATATTGG + Intergenic
1054114191 9:61143761-61143783 GAGCAGAAGCAAATCTATATTGG + Intergenic
1054125991 9:61309859-61309881 GAGCAGAAGCAAATCTATATTGG - Intergenic
1057604448 9:96489165-96489187 GAGCAAAAACACAATTTTTTGGG + Intronic
1059530578 9:115031690-115031712 GAGCAGAAGAAAAAGTATAATGG + Intronic
1062295687 9:135824937-135824959 CAGCAAATGCACAAGTGTACAGG + Intronic
1062758585 9:138323057-138323079 CAACAAAAGCAAAAATATATGGG - Intergenic
1185860724 X:3576751-3576773 GAGCAAAAGCCCAATTAACTTGG + Intergenic
1186087991 X:6012235-6012257 GAGCAAAAGCACAAGTTTTGTGG + Intronic
1187028178 X:15457470-15457492 AAGCACAAGCACAATTATAATGG - Intronic
1187065662 X:15834784-15834806 GAATAAAAGAAAAAGTATATTGG - Intronic
1187352128 X:18529494-18529516 GAGAGAAAGCAAAATTATATAGG - Intronic
1187823181 X:23309605-23309627 GAGTATAAGCACGATTATATGGG - Intergenic
1188038959 X:25350194-25350216 GAGCAAAAGCTCTATGATATTGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1191161452 X:57333957-57333979 GAGCAAAGACAGAATTATATTGG + Intronic
1194870218 X:99121598-99121620 GAGCAAAAGCAGAACTATCAGGG + Intergenic
1197354972 X:125427600-125427622 AAGACAAAGCAGAAGTATATTGG - Intergenic
1197578438 X:128252203-128252225 GAGAAAAATCAGAGGTATATTGG + Intergenic
1199374256 X:147088445-147088467 AAGCAAAAGGAAAAGTAAATGGG - Intergenic