ID: 951365673

View in Genome Browser
Species Human (GRCh38)
Location 3:21779091-21779113
Sequence AATCAACCACAGTCAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951365673 Original CRISPR AATCAACCACAGTCAGAGCT GGG Intronic
902057593 1:13615176-13615198 CTTCAACAACAGTCAAAGCTAGG - Intronic
902521604 1:17021024-17021046 AATCACCCACAGTCTTTGCTCGG + Intronic
903886562 1:26544232-26544254 ACCCAACCACAGACAGAGGTAGG - Intronic
905236990 1:36557130-36557152 AATCAACCACAAACAGACTTTGG + Intergenic
906273278 1:44498057-44498079 AAGCAACCACTGTCAGAGCTCGG - Intronic
907548743 1:55286223-55286245 AATGAACTAGAGACAGAGCTGGG + Intergenic
921508214 1:216000422-216000444 AATCCAGGACAGTCAGAACTGGG + Exonic
921945454 1:220883103-220883125 ACTCTTCCACAGTCAAAGCTCGG - Intronic
923299003 1:232623212-232623234 AATCACATACAGACAGAGCTAGG + Intergenic
923737648 1:236626333-236626355 AAACAACCACAGTCGGGGCAAGG - Intergenic
924524898 1:244837215-244837237 AACCGAGCACAGTCAGAGGTGGG + Intronic
924820875 1:247489382-247489404 AATCAACCCAATTCAGACCTTGG + Intergenic
1064484405 10:15770172-15770194 AATATACCACACTCAGAGATTGG + Intergenic
1066378654 10:34882723-34882745 ATCTAATCACAGTCAGAGCTAGG - Intergenic
1067030853 10:42878237-42878259 TATCAACCGCACTGAGAGCTTGG + Intergenic
1067344604 10:45428206-45428228 ACTCAACCCCAGTCAGAGCCAGG - Intronic
1070288885 10:75102142-75102164 AATATGCCACAGTCAGACCTGGG - Intronic
1078244862 11:9564799-9564821 AATCAGCCACAGAGAGATCTGGG - Intergenic
1085318191 11:75558637-75558659 AACAAGCCAGAGTCAGAGCTGGG - Intergenic
1088713207 11:112526598-112526620 AATTAACCAGTATCAGAGCTGGG + Intergenic
1088885418 11:114002463-114002485 GTTCAAACACAGTCTGAGCTGGG - Intergenic
1090836746 11:130459471-130459493 AAACAACCACTGTCAAAACTTGG - Intronic
1092529495 12:9332690-9332712 CATCAACCACGGCCAGTGCTGGG + Intergenic
1093297683 12:17411110-17411132 AAACAGCCACCGTTAGAGCTTGG - Intergenic
1100521676 12:95381211-95381233 AATCAACCATATTCATAGCTTGG - Intergenic
1101321174 12:103674243-103674265 AAAGAACCTCAGTCTGAGCTGGG + Intronic
1101506600 12:105352561-105352583 AATCAACCATACTCACAACTGGG - Intronic
1110065310 13:71097392-71097414 AATAAACCACAGTCACACATGGG + Intergenic
1114127584 14:19747843-19747865 AACCAACCAAAGGCATAGCTGGG - Exonic
1117662609 14:58022797-58022819 AACCAACCACAGACATACCTTGG + Intronic
1118108791 14:62692983-62693005 ATTCAGCCACAGTCAGAAGTTGG - Intergenic
1118765077 14:68904210-68904232 AGCCAGCCCCAGTCAGAGCTGGG + Intronic
1119971016 14:78970786-78970808 AATCAACCATACTCAGAGGAAGG - Intronic
1123571035 15:21609517-21609539 AACCAACCAAAGGCATAGCTGGG - Intergenic
1123607147 15:22044874-22044896 AACCAACCAAAGGCATAGCTGGG - Intergenic
1125757434 15:42072991-42073013 AATAAAACAAAGGCAGAGCTTGG - Intronic
1126764945 15:52002429-52002451 AAACTACCACAGTCAGAGCCAGG - Intronic
1127152607 15:56093709-56093731 AATCAAGCACAATCAGAAATTGG - Exonic
1131868949 15:96741963-96741985 TATGAAACACAGGCAGAGCTAGG - Intergenic
1202979387 15_KI270727v1_random:336641-336663 AACCAACCAAAGGCACAGCTGGG - Intergenic
1133628169 16:7591760-7591782 AAACAAGCACATTCTGAGCTTGG - Intronic
1133862725 16:9611505-9611527 TACTAAACACAGTCAGAGCTGGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136132565 16:28232977-28232999 AATCAACCAGAGTAAGCCCTAGG - Intergenic
1144957727 17:19027693-19027715 ACTCAACCACAGGCAGGGATAGG - Intronic
1144977430 17:19146827-19146849 ACTCAACCACAGGCAGGGATAGG + Intronic
1145115259 17:20204173-20204195 CAGAAACCACAGTCAGAACTGGG + Intronic
1145998230 17:29116584-29116606 ACACAACCACAGTCAGACTTGGG + Intronic
1146724181 17:35144159-35144181 ATACAGCCACATTCAGAGCTAGG - Intergenic
1147026085 17:37585208-37585230 AATCAATCACAGCCTCAGCTTGG + Intronic
1150478669 17:65492712-65492734 AATGAACCACAACCCGAGCTTGG - Intergenic
1151433271 17:74079356-74079378 AGCCAACCTCAGTGAGAGCTTGG - Intergenic
1152169771 17:78737080-78737102 ACTCAACCAAAGTCATAGCCAGG + Intronic
1153794830 18:8611816-8611838 ATTCAACCACACTCAGAGTAGGG - Intronic
1154138399 18:11801253-11801275 AATAAACCACAGTGTGGGCTGGG + Intronic
1156879305 18:42057582-42057604 AATCAAAGACGGTCAGAGCCTGG - Intronic
1157446850 18:47752812-47752834 AAACACTCAGAGTCAGAGCTGGG + Intergenic
1159708006 18:71717435-71717457 GATCAACCACTGGCTGAGCTTGG - Intergenic
1160187074 18:76684308-76684330 CATCAGCCACAGTCTGAGCTGGG - Intergenic
1161295081 19:3515417-3515439 AACAAACCACGGTCAGAGATGGG - Intronic
1162154946 19:8671315-8671337 AAGAAAACACAGTAAGAGCTGGG - Intergenic
928457916 2:31440447-31440469 AAGCAACCACAGGCAGGGCGCGG + Intergenic
929916861 2:46143655-46143677 CATCACCCACAGCCAGAGCTGGG + Intronic
931968415 2:67559303-67559325 CCTCAACCACAGTCATAGCCAGG - Intergenic
932813968 2:74846817-74846839 AATCAACCACAGTCAAAACAGGG - Intronic
933306560 2:80607424-80607446 CATCAAGCACACACAGAGCTTGG - Intronic
937414172 2:121701057-121701079 TAGAAACCACAGTCAGGGCTGGG + Intergenic
944824474 2:203467738-203467760 AATAAACCACAGTCATTCCTTGG - Intronic
948427701 2:237898206-237898228 GATAAACCATAGTCAGAGCCTGG + Intronic
1170235559 20:14100957-14100979 AACCAGCCACAGTCCGAGATGGG - Intronic
1171431695 20:25086899-25086921 AGACACCCACAGTCAGAGTTAGG - Intergenic
1173030963 20:39359251-39359273 AATCAGCCATATGCAGAGCTGGG + Intergenic
1175180221 20:57141214-57141236 AAACAACCTAAGTTAGAGCTGGG - Intergenic
1176139468 20:63538676-63538698 AACCGACCCCAGACAGAGCTGGG - Intergenic
1177950910 21:27535696-27535718 AAGCATCCAGAGCCAGAGCTAGG + Intergenic
1178703834 21:34856684-34856706 AATCAAAGACAATGAGAGCTAGG - Intronic
1182017293 22:27051493-27051515 AGTCAGCCAAAGGCAGAGCTGGG + Intergenic
1182248426 22:28979567-28979589 AATCAATAACTGTAAGAGCTAGG + Intronic
1182410192 22:30178720-30178742 AACCAAGCACAGTCAGAGTGAGG - Intergenic
1182990605 22:34763862-34763884 AATGAACCACAGTGATATCTGGG - Intergenic
1183208441 22:36434954-36434976 AAACAAACACAGACAGAGCAGGG + Intergenic
1183840038 22:40491870-40491892 AACCACCCAAAGTCAAAGCTTGG + Intronic
949095309 3:78656-78678 ATGCAAACACAGTCTGAGCTTGG + Intergenic
949833290 3:8240137-8240159 AACCAGCCGCAGACAGAGCTGGG + Intergenic
949855887 3:8460694-8460716 AATAAAGCATAGTCAGAACTTGG - Intergenic
949897380 3:8778291-8778313 AGGCAACCACAGGAAGAGCTGGG - Intronic
950984567 3:17347665-17347687 AATCAAAGAAAGTCTGAGCTCGG + Intronic
951365673 3:21779091-21779113 AATCAACCACAGTCAGAGCTGGG + Intronic
955608843 3:60735760-60735782 ATTAAGCCACAGTTAGAGCTAGG + Intronic
958598412 3:96260619-96260641 CAGCACCCACAGCCAGAGCTTGG + Intergenic
960810743 3:121624926-121624948 TATCAATCAGAGTCACAGCTGGG - Intronic
962340535 3:134578623-134578645 AATCAATCACAGTGAGGGCTGGG - Intergenic
965537887 3:169843005-169843027 AATCTACCACATTCAGTCCTGGG - Intronic
970061340 4:12037874-12037896 AAAAAACCACAGTCTGGGCTGGG - Intergenic
972495967 4:39635117-39635139 TATCAACCACAGCAAGATCTGGG + Intronic
974581036 4:63801814-63801836 AATCAATGACAGTCATAGCAGGG - Intergenic
974755355 4:66199177-66199199 AATTAACAAAAATCAGAGCTGGG - Intergenic
981013516 4:139950665-139950687 AATCTACCACAGTCAAACCCGGG - Intronic
981434452 4:144703640-144703662 GAACACACACAGTCAGAGCTGGG + Intronic
990129343 5:52561255-52561277 AATAAAGCACATTAAGAGCTAGG - Intergenic
991214688 5:64148826-64148848 ACTCCACCACAGACACAGCTGGG - Intergenic
993904606 5:93608978-93609000 AATTAACAACACACAGAGCTCGG + Intergenic
995091991 5:108189034-108189056 AATCACCCACAGTCATGGCTGGG + Intronic
997543596 5:134685620-134685642 AAATAGCCACAGTCAGAACTGGG - Intronic
997825962 5:137106987-137107009 AGTCAACCAGAGTAAGAGCTGGG - Intronic
998183379 5:139961125-139961147 AAACAGCCTGAGTCAGAGCTGGG - Intronic
998530801 5:142882720-142882742 AATAAACCACATACAGTGCTTGG - Intronic
999090932 5:148935337-148935359 AAGCAGACACAGTCAGGGCTGGG + Intronic
1001961806 5:175884177-175884199 AATCAACCGCAGCCAGAGTTGGG + Intergenic
1002602650 5:180362826-180362848 AAACAGCCACACTCAGTGCTGGG - Intergenic
1006254190 6:32816578-32816600 TATCAACCTCAGTCAGTGCCTGG - Intronic
1009944538 6:70327940-70327962 AAGCATGAACAGTCAGAGCTAGG + Intergenic
1015044896 6:128765441-128765463 AAACAAACACAGTCAGAAATTGG + Intergenic
1016189285 6:141241835-141241857 TCTCAACCACAGTAAGAGTTAGG + Intergenic
1018323213 6:162635236-162635258 AATCAACTGCATTCTGAGCTAGG + Intronic
1020450273 7:8314160-8314182 AAGCACCCACAGCCAAAGCTAGG - Intergenic
1021479497 7:21100550-21100572 AATCAACCACAGTCAAAGAAAGG + Intergenic
1023981321 7:45072276-45072298 CAGAAACCACAGTCAGAGCCGGG - Intronic
1024656581 7:51455801-51455823 AATCAAAGACTGTCAGAGTTGGG + Intergenic
1025194081 7:56919056-56919078 AACCAACCACACTCAGAGCTGGG + Intergenic
1025677867 7:63657888-63657910 AACCAACCACACTCAGAGCTGGG - Intergenic
1027530549 7:79325918-79325940 AATTAACCACATTGAGTGCTGGG + Intronic
1029459607 7:100687305-100687327 AATCCAGCGCAGCCAGAGCTGGG - Exonic
1029672083 7:102040311-102040333 AACCAGCCACACTCAGAGCTGGG + Intronic
1031006360 7:116476931-116476953 CTTCAACCAAACTCAGAGCTTGG + Intronic
1031359945 7:120837278-120837300 AATAAACCACACTCAGAGATGGG - Intronic
1033006409 7:137569284-137569306 CTTCTACCACAGTCAGAACTAGG + Intronic
1035372217 7:158386784-158386806 AAACCACCACAGCAAGAGCTGGG - Intronic
1035858630 8:3004318-3004340 TAGCAACAACAGTCACAGCTCGG + Intronic
1038169176 8:25113248-25113270 AATCAACCACATTGGGAGATGGG + Intergenic
1038208653 8:25494162-25494184 AATCAAAAACACTCAGGGCTGGG + Intronic
1038414551 8:27384843-27384865 AAACAACCTCAGACAGCGCTTGG - Intronic
1038715588 8:29987964-29987986 AGTCAATCACAGGCAGAGATTGG + Intergenic
1041585536 8:59513094-59513116 TATCAACTACAGTCAGAGTTAGG - Intergenic
1044533967 8:93338801-93338823 CACCAACCACAGTCAGAGAAAGG + Intergenic
1045527185 8:102951025-102951047 AAACAGCCACAGTGGGAGCTGGG + Intronic
1049557976 8:143292926-143292948 AATAAATCACAGCCAGGGCTAGG - Intronic
1051678338 9:19581136-19581158 AATCAGCCACATTCAGACCCAGG + Intronic
1051897015 9:21997353-21997375 AGTCAACCACAGTCACATATTGG - Intronic
1055294971 9:74824967-74824989 AATCAACCACAGGCTGGGCATGG + Intronic
1059263910 9:113007824-113007846 AATTAGCCACTGGCAGAGCTAGG + Intergenic
1185860522 X:3574452-3574474 AATCACACACAGAGAGAGCTGGG + Intergenic
1186273935 X:7919802-7919824 CATGAACCACAGTCACAGCTGGG + Intronic
1186479283 X:9883767-9883789 AAGGAAGCAGAGTCAGAGCTGGG + Intronic
1186512357 X:10139283-10139305 AACCAACCACAGTCAGCGAGTGG - Intronic
1191676009 X:63793221-63793243 AGACAACAACAGTCAAAGCTTGG + Intergenic
1193586150 X:83323943-83323965 AATCAAACATACTCAGAGGTAGG - Intergenic
1194335615 X:92643173-92643195 AATCACCCAGAGTCAAAACTAGG - Intergenic
1194866353 X:99073434-99073456 AATCAAACGGTGTCAGAGCTGGG - Intergenic
1198124515 X:133629362-133629384 AATCATAGACTGTCAGAGCTGGG - Intronic
1199675999 X:150189879-150189901 AATACACCTCAGTCAGGGCTGGG - Intergenic
1200644044 Y:5759924-5759946 AATCACCCAGAGTCAAAACTAGG - Intergenic
1201448363 Y:14082986-14083008 CATGGACCACAGTCACAGCTGGG - Intergenic