ID: 951374541

View in Genome Browser
Species Human (GRCh38)
Location 3:21897254-21897276
Sequence TTATTGATAAACAGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951374537_951374541 8 Left 951374537 3:21897223-21897245 CCTGCCACATGGCTATTTCAGAA 0: 1
1: 0
2: 0
3: 14
4: 167
Right 951374541 3:21897254-21897276 TTATTGATAAACAGGCAAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 229
951374538_951374541 4 Left 951374538 3:21897227-21897249 CCACATGGCTATTTCAGAATTCT 0: 1
1: 0
2: 3
3: 21
4: 234
Right 951374541 3:21897254-21897276 TTATTGATAAACAGGCAAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951374541 Original CRISPR TTATTGATAAACAGGCAAGA GGG Intronic
903279955 1:22244798-22244820 TTACTGATAACCAGGGGAGAAGG + Intergenic
904397879 1:30234838-30234860 TGATTATTAAACAGGCAGGATGG - Intergenic
905613953 1:39380946-39380968 TTAATGATAAAAATGAAAGATGG + Intronic
906497255 1:46313685-46313707 ATATAGATAACCAGGCAAGCTGG + Intronic
908870331 1:68603276-68603298 TTTATAATAAAAAGGCAAGAAGG - Intergenic
909754846 1:79212314-79212336 TTATTGATAAATAGTGCAGATGG + Intergenic
910371507 1:86521150-86521172 TGATGGATAAACAAGGAAGAAGG + Intergenic
910560501 1:88584848-88584870 TTATTGATAAGAAGGAAAGAAGG - Intergenic
912596725 1:110886187-110886209 TTATTGGAAAACAGGCAAGCTGG - Intronic
913358022 1:117945409-117945431 TTATGGATAAATGGGGAAGATGG - Intronic
918035232 1:180864681-180864703 GTATTAATAAAAAGACAAGAGGG + Intronic
918117596 1:181510335-181510357 TTATTTGTAAACAGGCAGGCAGG - Intronic
918578432 1:186094552-186094574 ATTTTGATAAACAGACAATATGG - Intronic
919468872 1:197954314-197954336 TAATTGAGGAAAAGGCAAGATGG - Intergenic
920307415 1:205027883-205027905 TTACTGTCAAAGAGGCAAGAAGG + Intergenic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
923062226 1:230486366-230486388 GTATTGATAACTAGGCCAGATGG - Intergenic
1063591786 10:7402068-7402090 TGTTTGGTACACAGGCAAGATGG + Intronic
1063609190 10:7548595-7548617 TTATTGATAATCTGGAAATAGGG + Intergenic
1064383440 10:14867625-14867647 TTATTGATAAACAGGACACTAGG - Intronic
1065031201 10:21587854-21587876 CTATTGATAAACTGGGCAGATGG - Intronic
1065756542 10:28935982-28936004 TTATTGTTAAAGAGGAAAGTGGG + Intergenic
1066974101 10:42349202-42349224 CTATTGAAAATCAGCCAAGAAGG + Intergenic
1067973959 10:51002895-51002917 ACTTAGATAAACAGGCAAGAAGG + Intronic
1068000956 10:51333601-51333623 TTTTGGATAAACAGGGAAAATGG - Intronic
1068238326 10:54268153-54268175 TAATTGATAAAAATGCAATAGGG + Intronic
1069180893 10:65357221-65357243 TTAGTGATAAGCAGAAAAGAGGG - Intergenic
1069287700 10:66736553-66736575 TTATTAATAAACAGGTAAGATGG - Intronic
1074148312 10:110736712-110736734 TTACTGAAAAAAAGGAAAGAAGG - Intronic
1075221024 10:120584639-120584661 CTCTTGATAGACAGGCAAGCAGG - Intronic
1078237104 11:9495602-9495624 TTACTGATAAATAGTGAAGATGG - Intronic
1082929884 11:58591570-58591592 TTAACTATAAACAGGCATGAAGG - Intronic
1083315860 11:61814882-61814904 TTATTGAAAGACCCGCAAGAAGG - Intronic
1084490030 11:69473176-69473198 GTATAGACAAACTGGCAAGATGG + Intergenic
1087318228 11:96629793-96629815 CTATTGATAGACAGGAAAAAAGG + Intergenic
1087476168 11:98637772-98637794 TTATTGAGAATCAGGCATGCAGG - Intergenic
1088891678 11:114049589-114049611 TGATTAATCAACAGGGAAGAAGG + Intergenic
1090920193 11:131200114-131200136 TTTTTGAAAAAAAGGAAAGAAGG + Intergenic
1091987402 12:4922837-4922859 ATATTGCTCAACAGGTAAGAAGG - Intronic
1092076756 12:5680372-5680394 ATATTGAAAAAAAGGAAAGAGGG + Intronic
1092989890 12:13886528-13886550 GTATTGATGAACAAGCAGGAAGG + Intronic
1094308730 12:29053015-29053037 TTATTGATAAAGATAGAAGATGG + Intergenic
1094401989 12:30071500-30071522 TTATTTATAAACAGGAACAAAGG + Intergenic
1095435700 12:42185401-42185423 TAATTGATAAAGAAGCAACAGGG + Intronic
1097354768 12:58588893-58588915 TTTTTGTAAAAGAGGCAAGAGGG - Intronic
1097862313 12:64530246-64530268 TTATTGATGCACATGCAATATGG - Intergenic
1098091372 12:66905436-66905458 ATACTGAGAAACAGACAAGAGGG + Intergenic
1098217096 12:68232349-68232371 TTATTAATCCAGAGGCAAGATGG - Intergenic
1098645130 12:72890571-72890593 TTATTGGTAAGCAGGTAATATGG + Intergenic
1099518465 12:83628787-83628809 ATGTTCTTAAACAGGCAAGAGGG - Intergenic
1100107711 12:91197112-91197134 TTATTGATTAATAGGAATGAAGG + Intergenic
1100625491 12:96327300-96327322 TGTTTGAAAAACAGGCAATAGGG + Intronic
1101584094 12:106069111-106069133 CTATGGATAATCAGGCTAGACGG - Intronic
1102392240 12:112558500-112558522 TTCAGGGTAAACAGGCAAGATGG - Intergenic
1103211732 12:119172082-119172104 TTATTGATACACATGAAAGCAGG + Intergenic
1105006890 12:132727162-132727184 TTATTGCTAAACTGTCAAAAAGG - Exonic
1105641025 13:22264296-22264318 TTGTTCATAAACAGGCATCAAGG + Intergenic
1107031558 13:35859194-35859216 TTGTTGTTAAACAGCCAAGCAGG + Intronic
1108067752 13:46595996-46596018 TTAGTTTTAAACAGGCAAAAAGG + Intronic
1108349508 13:49578815-49578837 TTATTGCTAAAAAAGGAAGAAGG - Intronic
1108582892 13:51841809-51841831 ATTTTCATAAACTGGCAAGATGG + Intergenic
1109269894 13:60243681-60243703 ATATAGATAAACAAACAAGAAGG - Intergenic
1109368301 13:61387585-61387607 TTTTTGATAAAAGGGAAAGAAGG + Intergenic
1109386594 13:61636784-61636806 TTATAGATAAAAAAGGAAGAGGG - Intergenic
1109910204 13:68899951-68899973 TTATTATTTAACAGACAAGATGG - Intergenic
1110119144 13:71861827-71861849 TCATTGAAAACCAGGCAACAGGG + Intronic
1110373083 13:74761411-74761433 TTATTGATAAACAAGAAAAATGG - Intergenic
1110872776 13:80471836-80471858 TTATGAATAAATAGGAAAGAAGG - Intergenic
1112070260 13:95842384-95842406 TTATTTATACACAGACAACATGG - Intronic
1113033418 13:106020030-106020052 TTATTGATAAAAACTGAAGATGG - Intergenic
1115207330 14:30923416-30923438 GTATTGATAATCAGGCCAGAAGG + Intronic
1115847341 14:37554603-37554625 TGATTTCTAAACAGGTAAGAGGG - Intergenic
1116261857 14:42639688-42639710 TTATTGATAAATATGCAATTAGG - Intergenic
1119050213 14:71359754-71359776 TTATTGCCAAACAAGCAAGGAGG - Intronic
1119794720 14:77385566-77385588 GTAGTTATAAACAGGCAAGGGGG - Intronic
1120497998 14:85260177-85260199 TTCTTTATAACAAGGCAAGAAGG + Intergenic
1121990735 14:98554274-98554296 TTCTTGGTAAACTGCCAAGAAGG - Intergenic
1124866441 15:33496723-33496745 TTATTCATATATGGGCAAGAAGG - Intronic
1129002596 15:72346767-72346789 TTATTCATACACAGGCAACATGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1131415273 15:92250263-92250285 TTTTTTAAAAACAGGCAATAAGG - Intergenic
1139228577 16:65257805-65257827 TTATTTATAAGTAGACAAGATGG - Intergenic
1140590471 16:76345932-76345954 TTTTTGTTTCACAGGCAAGAAGG - Intronic
1141121347 16:81360100-81360122 TGATTGATAGACAGGCAGGTAGG + Intronic
1144172122 17:12667957-12667979 TCATTGATAAACAGGGAATCTGG + Intronic
1145185934 17:20794228-20794250 TTCTTGATAAAAAGAAAAGAAGG - Intergenic
1146075781 17:29727350-29727372 TTAGTGAAAAACTGGCAAGCAGG + Intronic
1147061449 17:37882442-37882464 CTATTGATAAACTGGGCAGATGG + Intergenic
1147407094 17:40219778-40219800 TTTTTGAGAGACAGGCAATAAGG + Intronic
1147777528 17:42913102-42913124 AGATTGAAAAACAGGCAAGGAGG - Exonic
1148411184 17:47468620-47468642 TTCTTGATAAAAAGAAAAGAAGG + Intergenic
1148588178 17:48795871-48795893 TTAATGATTAACAGCCAAGAGGG + Intronic
1150520078 17:65857183-65857205 TTAGTGATAAGCAGAAAAGAGGG - Intronic
1151050715 17:70975790-70975812 TTATTGATAAAGATGGAACATGG + Intergenic
1153128101 18:1820489-1820511 TTATTAATCAACAGGCACAATGG - Intergenic
1156523575 18:37743780-37743802 ATTTTGATAAACAGACAAAAAGG + Intergenic
1156852123 18:41740925-41740947 TAATTGGTAAACAAGCAATAGGG + Intergenic
1156877951 18:42039005-42039027 TTACTGAGAAACAGGAAAGAAGG - Intronic
1157626993 18:49059409-49059431 ATATTAATAAAAAGGAAAGAAGG - Intronic
1159109407 18:64039397-64039419 TTATTGATAAAAAAGTAAGTGGG - Intergenic
1166208565 19:41290041-41290063 TTAGAGATGAACAGGCATGAGGG + Intronic
1168459976 19:56546431-56546453 TTCTTGACCAACTGGCAAGATGG - Intronic
925729679 2:6910047-6910069 TTCTTCATACACATGCAAGATGG + Intergenic
929104873 2:38354991-38355013 TGAATGAAAAACACGCAAGATGG + Intronic
932459073 2:71870845-71870867 TTCTGGTTAAAGAGGCAAGATGG + Intergenic
934105666 2:88692296-88692318 TTATTGATAAGGAGGCCACAAGG - Intronic
935652181 2:105391807-105391829 TTATTGATAACCTGTCAGGAGGG - Intronic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
937847258 2:126594540-126594562 CTATTTATTAACAGACAAGATGG + Intergenic
938066630 2:128285151-128285173 TTACTGGAAAACAGGCTAGATGG - Intronic
938539835 2:132276821-132276843 TGATTGATAGACAGGCAGGCAGG + Intergenic
939173973 2:138728430-138728452 TTATTGTTATACATGGAAGATGG - Intronic
940074290 2:149723214-149723236 TTCTTGATAAGCAGTGAAGAAGG - Intergenic
942590884 2:177545799-177545821 TTTTTGCCAGACAGGCAAGAAGG + Intergenic
943165335 2:184315506-184315528 TAATTGTTAACCAGGCATGATGG - Intergenic
943545981 2:189278378-189278400 TAATTATTAACCAGGCAAGAAGG - Intergenic
944281921 2:197907761-197907783 CCATTGAAAAAGAGGCAAGAAGG - Intronic
944611763 2:201416486-201416508 TTAAAGTTAAACAGGCAAAAAGG + Intronic
947319194 2:228897517-228897539 TTTATCATCAACAGGCAAGACGG - Intronic
948289927 2:236817284-236817306 TTAATGAAAAAGAGGAAAGAAGG - Intergenic
1170119362 20:12895013-12895035 GTATTCATAAGGAGGCAAGAGGG + Intergenic
1171868771 20:30509863-30509885 TGATTGATATACAGGCAGGCAGG + Intergenic
1173641702 20:44607655-44607677 TAAATGAAAAAAAGGCAAGATGG + Intronic
1174209331 20:48865007-48865029 TTTTTGACAATCAGGCAAGGAGG + Intergenic
1174585827 20:51607446-51607468 TTCTTGTTCTACAGGCAAGAAGG + Intronic
1177720637 21:24902503-24902525 CTATTGACAAACAGGCAGGAAGG + Intergenic
1180521321 22:16209054-16209076 CTATTGAAAATCAGCCAAGAAGG + Intergenic
1181035801 22:20169286-20169308 TTAATGACACACAGGAAAGAAGG - Intergenic
1181144778 22:20837090-20837112 TTATAAATAAACAGGCAAGCTGG + Intronic
1181981690 22:26771450-26771472 TTAGAGAGAATCAGGCAAGAGGG + Intergenic
1183552976 22:38503524-38503546 TTAATTATAAACATGGAAGACGG - Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1185350444 22:50333848-50333870 TTATTGTTTACAAGGCAAGAGGG + Intergenic
949781683 3:7696370-7696392 TTCTTGAAAAGGAGGCAAGATGG + Intronic
951374541 3:21897254-21897276 TTATTGATAAACAGGCAAGAGGG + Intronic
951400584 3:22228082-22228104 TGATTGACAGAGAGGCAAGATGG + Intronic
951522683 3:23624113-23624135 TTTTTGAGAAACTGCCAAGAAGG - Intergenic
951626029 3:24663851-24663873 TTACTGATAAAGAGGAAAAAAGG - Intergenic
952037053 3:29215346-29215368 TTATTAATGAACAGACAATAAGG + Intergenic
952862748 3:37828262-37828284 TGGTAGATAAAGAGGCAAGAAGG - Intergenic
953850313 3:46461641-46461663 TTAACTATAAACAGGCATGAGGG + Intronic
953970144 3:47340942-47340964 TAATGGAAATACAGGCAAGAGGG + Intronic
955789961 3:62578827-62578849 TTATTGATAAGAAGTCAACAAGG + Intronic
955965955 3:64389613-64389635 TTAGTGACACACAGGCTAGATGG - Intronic
957011377 3:75009342-75009364 TTAATGATTCCCAGGCAAGATGG - Intergenic
959032669 3:101319048-101319070 CTATTAATAAATAGGCAAGCAGG + Intronic
959655252 3:108796877-108796899 TTATAGATAAACAGGGGAGGAGG + Intergenic
962048891 3:131791799-131791821 TTATTGATACACTTGCAGGATGG + Intronic
962573194 3:136732192-136732214 TTATAGATACAAAGGCAACATGG - Intronic
963400774 3:144795586-144795608 TTTTTCATAATCAGGCAACAAGG + Intergenic
963493370 3:146029280-146029302 TGATTGTTAAAAAGTCAAGAAGG - Intergenic
966976623 3:185089909-185089931 TTATTGCCAAACAGCAAAGAAGG - Intronic
967364136 3:188666605-188666627 TTATTTTTCAACAGGAAAGAAGG + Intronic
969851992 4:9964822-9964844 TTGTTGATGGAGAGGCAAGAGGG - Intronic
971972944 4:33643954-33643976 TTATTTAAAATCAGGCAAAAAGG - Intergenic
974887521 4:67838321-67838343 TTTATGATTTACAGGCAAGATGG - Exonic
976218006 4:82732730-82732752 TTATTGATAGCCATGCAAGCTGG + Intronic
976475348 4:85476190-85476212 TTAATGATAAACATGTAATATGG + Intronic
976756672 4:88506009-88506031 CTAGTGATAAGCAGGAAAGAGGG + Exonic
977094726 4:92726115-92726137 TTCCTGGTAAACAGGCAAAATGG - Intronic
977936051 4:102805846-102805868 CTATTAATAAACAGGAAAAAAGG - Intronic
978177587 4:105752393-105752415 TTATTGATAATCAGTCATTATGG - Intronic
978458035 4:108917223-108917245 TTATTGATAGAAAGAAAAGATGG + Intronic
978643550 4:110900721-110900743 ATTTTGAGAAACAGGCAAAAAGG - Intergenic
978874554 4:113623131-113623153 TTATTGCTTTACAGGCAACAAGG - Intronic
980724634 4:136742605-136742627 TTATTCATAAAGGGGCATGAGGG + Intergenic
983235630 4:165176095-165176117 TGATGGATGAACAGGCAACAAGG - Intronic
983863513 4:172736115-172736137 TCATTGATGAACAGGAAACAGGG + Intronic
985066061 4:186123457-186123479 TTATTAATAAAGAGCCATGAAGG - Intronic
986207311 5:5637065-5637087 TTACTGAAAAGCAGGCTAGAAGG - Intergenic
989195802 5:38714870-38714892 TGATTGAGAAACAGGAAAAAAGG - Intergenic
990952621 5:61313055-61313077 TCATTGATGACCAGGCACGATGG + Intergenic
992141497 5:73801539-73801561 TTATTAAATAACAGCCAAGAGGG - Intronic
994052791 5:95381441-95381463 TTACTGATAAACAGGTTAGAGGG + Intergenic
994977304 5:106826307-106826329 TTATTGAAAAAGATGCATGAAGG + Intergenic
996792759 5:127310703-127310725 TTATGGATAAAAAGAAAAGAGGG + Intronic
996837766 5:127812922-127812944 TTAGAGATAAACAGGTAGGAGGG - Intergenic
1000793094 5:165630988-165631010 ACATTGATAAACAGGCGTGAAGG + Intergenic
1002711949 5:181200523-181200545 TAACTGCTAAACAGGAAAGATGG - Intronic
1002957492 6:1881129-1881151 TAATTTAAAAACAGGCAGGAGGG + Intronic
1003202852 6:3978286-3978308 TTATTGAAAAACAGAAAAGTGGG - Intergenic
1003294758 6:4815572-4815594 GTATTGATACACATGCAGGAAGG - Intronic
1005209450 6:23443546-23443568 TTATATATACACAGGCAAGAGGG + Intergenic
1010178984 6:73062800-73062822 TAATTGAGAAAAAGGCAATATGG - Intronic
1012271871 6:97223138-97223160 TTATTCCTAAACAGCCTAGAGGG + Intronic
1012666217 6:101974134-101974156 TTATTTACAAAAAGACAAGATGG - Intronic
1014654353 6:124080782-124080804 TTATAGAAATACAGGAAAGAAGG - Intronic
1014991881 6:128089940-128089962 TTGCTGAAATACAGGCAAGACGG - Exonic
1015517344 6:134096658-134096680 TTTTTGAAAAACAAGTAAGAGGG + Intergenic
1015965120 6:138690425-138690447 TTTTTAATAATCATGCAAGAAGG - Intronic
1019454413 7:1117960-1117982 TTATTCAAAAACAGACAAAAAGG + Intronic
1020554134 7:9649441-9649463 TTATTGATAAATATGTAGGAAGG + Intergenic
1020628681 7:10614607-10614629 CTATTGACATACAGGAAAGATGG - Intergenic
1020946454 7:14614581-14614603 ATATTGTTAAACAGGAAGGAAGG - Intronic
1023416436 7:39937618-39937640 TGATTGAAATACAGGCATGATGG + Intergenic
1024428619 7:49260223-49260245 TTATTTTTAATAAGGCAAGAGGG + Intergenic
1024840586 7:53582490-53582512 TTATTGATACAAAGACAACATGG - Intergenic
1028455629 7:91035395-91035417 ATATTGATATACAGCAAAGAAGG - Intronic
1028994898 7:97089453-97089475 TTTTTGAAAAACAAGAAAGATGG - Intergenic
1029080461 7:97969807-97969829 TAATTGAAAAACAGTAAAGATGG - Intergenic
1030894163 7:115036853-115036875 TTATTTATAAACAGACAATTTGG - Intergenic
1030946086 7:115722481-115722503 TTGTAGATAAACAGGAAAGAGGG + Intergenic
1032731250 7:134645526-134645548 ATATTGAGAAAAAAGCAAGAGGG + Intergenic
1033119505 7:138654707-138654729 TTACTGCTCACCAGGCAAGATGG + Intronic
1033642147 7:143271564-143271586 TTATTGATCAGAAGGGAAGAGGG - Intergenic
1033672293 7:143504721-143504743 TTAATGATAATGAGACAAGATGG + Intergenic
1037344952 8:17888996-17889018 TAATTGCTAAACAGGCTTGATGG + Intronic
1037465051 8:19151615-19151637 TTATCCTTAATCAGGCAAGAGGG - Intergenic
1038031084 8:23640885-23640907 TTATTGATAGACACTAAAGAAGG - Intergenic
1038544365 8:28413679-28413701 AGATTGATAAAAAGGGAAGAAGG - Intronic
1039325824 8:36484425-36484447 TTATCTTTAGACAGGCAAGAGGG + Intergenic
1039563366 8:38530695-38530717 TTCCTGATCAACTGGCAAGAAGG + Intergenic
1042852431 8:73229296-73229318 TTTTTGGTAAAAAGGCTAGAGGG - Intergenic
1042892472 8:73627445-73627467 GTATTCACAAACAGGGAAGAAGG - Intronic
1043135843 8:76523493-76523515 TTATAAATTAACAGGCAAAATGG + Intergenic
1043803993 8:84647768-84647790 TCATTATTAAACAGGAAAGAAGG + Intronic
1046493425 8:114983079-114983101 TTAAAGATAAACAAGAAAGAAGG + Intergenic
1047628275 8:126678724-126678746 CTGTTGAGAAACAGCCAAGAGGG - Intergenic
1049124120 8:140770798-140770820 TCCTTTATAAAGAGGCAAGAGGG + Intronic
1050974014 9:11912875-11912897 TGATTGATTCCCAGGCAAGATGG - Intergenic
1051272363 9:15367823-15367845 TTATTTATAATCACCCAAGATGG - Intergenic
1051944170 9:22546233-22546255 TTATTGATGAGGAAGCAAGATGG + Intergenic
1053516645 9:38735898-38735920 TTCTTAAAAAACAGGCAAAACGG - Intergenic
1053811149 9:41853627-41853649 TTATAGAGAAACGGGGAAGAAGG - Intergenic
1054619445 9:67333812-67333834 TTATAGAGAAACGGGGAAGAAGG + Intergenic
1056514914 9:87341110-87341132 TTTTTCTTTAACAGGCAAGATGG + Intergenic
1057095189 9:92300390-92300412 TCATTTATAAATAGACAAGAGGG - Intronic
1058705516 9:107634728-107634750 TTCTTGAGACAAAGGCAAGAGGG + Intergenic
1060899478 9:127245046-127245068 TTAGTGATAAAGAGGGAAGACGG - Intronic
1062126917 9:134868891-134868913 TTATTCACAAACAGGCACGGTGG - Intergenic
1189039874 X:37530906-37530928 TTTTGGATCACCAGGCAAGATGG - Intronic
1190268552 X:48844609-48844631 TTATTAATGAACAGGCATAAAGG + Intergenic
1190505768 X:51124922-51124944 TTATAGATTCTCAGGCAAGATGG + Intergenic
1193795891 X:85872653-85872675 TTCTTGGTAAACAGTCAAGAAGG - Intronic
1194222354 X:91209763-91209785 TTATGGTTAAACAGGAAAGTAGG + Intergenic
1194369247 X:93050442-93050464 TTATTTATGAAAAGGCATGAAGG - Intergenic
1194691305 X:96989187-96989209 TTATTGACAAACTGCCAAAATGG + Intronic
1194750880 X:97682839-97682861 TTATTGAAAAACACACAAGCGGG - Intergenic
1195488494 X:105438813-105438835 TTACTAATCAACAGGAAAGAGGG - Intronic
1196766635 X:119251796-119251818 TTATTGATAATAAGGCTAGCTGG - Intergenic
1198085334 X:133277133-133277155 TTATTTAATAACAGGCAAGAAGG - Intergenic
1198696990 X:139352505-139352527 TTATTGATAAGCAGGAAGCAGGG + Intergenic
1199661673 X:150056971-150056993 TGATTGCTAAAAAGGGAAGAAGG - Intergenic
1200330691 X:155293416-155293438 TTCTTTATATCCAGGCAAGAAGG - Intronic
1200558874 Y:4673537-4673559 TTATGGTTAAACAGGAAAGTAGG + Intergenic
1201697521 Y:16842088-16842110 TAATTAAGAAAAAGGCAAGATGG + Intergenic
1202603819 Y:26621669-26621691 TTCTTCATATACAGGTAAGAAGG + Intergenic