ID: 951381880

View in Genome Browser
Species Human (GRCh38)
Location 3:21994979-21995001
Sequence GCAGTGATGTTAGTGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 12, 3: 65, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951381877_951381880 -4 Left 951381877 3:21994960-21994982 CCTCAGATGGCATACATGTGCAG 0: 1
1: 0
2: 0
3: 12
4: 138
Right 951381880 3:21994979-21995001 GCAGTGATGTTAGTGGGTCCAGG 0: 1
1: 0
2: 12
3: 65
4: 295
951381876_951381880 -3 Left 951381876 3:21994959-21994981 CCCTCAGATGGCATACATGTGCA 0: 1
1: 0
2: 3
3: 13
4: 106
Right 951381880 3:21994979-21995001 GCAGTGATGTTAGTGGGTCCAGG 0: 1
1: 0
2: 12
3: 65
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951381880 Original CRISPR GCAGTGATGTTAGTGGGTCC AGG Intronic
900329941 1:2129061-2129083 GCAGGGATGTTGGGGGGACCTGG - Intronic
900374941 1:2349402-2349424 GCAGGGATGTCAGAGGGGCCGGG - Intronic
900375669 1:2353483-2353505 GGGGTGATGCTGGTGGGTCCAGG + Intronic
905053353 1:35072160-35072182 GCAGTGAAGCCATTGGGTCCTGG + Intronic
905084895 1:35364230-35364252 GCAGTAATGTGAGTAGGTCCTGG + Intronic
905731426 1:40301594-40301616 GAAGTGATGGTGGTGGATCCTGG + Intronic
905964512 1:42081020-42081042 GCAGCAGTGTCAGTGGGTCCAGG + Intergenic
907471307 1:54675485-54675507 CCAGAGATGTGAGTGGCTCCTGG - Intronic
908538764 1:65103217-65103239 GCACCAACGTTAGTGGGTCCTGG + Intergenic
908672650 1:66565068-66565090 GCAGTGGAGTCAGGGGGTCCTGG - Intronic
910716044 1:90231959-90231981 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
911924983 1:103817889-103817911 GCACTAGTGTTAGTGGGTGCAGG - Intergenic
913707277 1:121438560-121438582 GCAGTAAAGTCATTGGGTCCTGG - Intergenic
916616036 1:166441149-166441171 GCAGTGAAGCCACTGGGTCCTGG + Intergenic
917320655 1:173778019-173778041 GCAGTGAGGCCATTGGGTCCTGG + Intronic
919590310 1:199493865-199493887 GCACCAGTGTTAGTGGGTCCTGG - Intergenic
920426343 1:205879617-205879639 GCATTAGTGTTAGTGGGTCCAGG + Intergenic
920804122 1:209216925-209216947 GCACCAATGTTAGTGGGCCCAGG - Intergenic
921112958 1:212056203-212056225 GCACTGGTGTTAATGGATCCAGG - Intronic
921823507 1:219644686-219644708 GCAGTGAAGCCACTGGGTCCTGG - Intergenic
922432302 1:225567508-225567530 TCAGTGCTGTTATTGGGTGCTGG + Intronic
922621061 1:226988485-226988507 GCAGTTATGGTCGTGGTTCCTGG - Intergenic
1063336144 10:5216288-5216310 CCAATGATGGAAGTGGGTCCTGG - Intronic
1063486390 10:6424537-6424559 GCATTGTTGTGAGTGGGTTCTGG + Intergenic
1065041757 10:21704990-21705012 GTACTGGTGTTAGTGGGTCCAGG + Intronic
1065142468 10:22732324-22732346 CCAGTGAAGCTAATGGGTCCTGG + Intergenic
1065147905 10:22790387-22790409 GCAGTGAAGTCATTAGGTCCTGG + Intergenic
1066142622 10:32522282-32522304 GCAGTGAAGCCACTGGGTCCTGG + Intronic
1067706653 10:48611348-48611370 GCAGTCCTGTTTCTGGGTCCTGG + Intronic
1068250373 10:54431141-54431163 GCAGTGAAGCTATTGGGTCCTGG - Intronic
1068641889 10:59417885-59417907 GCAGTGAAGTCATTGAGTCCTGG - Intergenic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1070263470 10:74880203-74880225 GCAGTGATGCTAATGGGTATAGG - Intronic
1071823180 10:89298224-89298246 GCACTGGTGTTAGTGGGACCAGG - Intronic
1071928816 10:90441605-90441627 GCACTGATGTTAGTTGGTTCAGG - Intergenic
1071963378 10:90828724-90828746 GCAGTGAAGCCATTGGGTCCTGG - Intronic
1072369558 10:94751098-94751120 GCAGTGAAGCCATTGGGTCCTGG + Intronic
1073645211 10:105294278-105294300 GCATTGGTATTAGTGGGTACAGG - Intergenic
1075589974 10:123684221-123684243 GCAGCGATGTTTGTGGGGACAGG + Intronic
1075796921 10:125127235-125127257 GCAGTGATGTCAGTGGTTGCGGG - Intronic
1075827071 10:125367578-125367600 GCAGTGAAGTCATTTGGTCCTGG - Intergenic
1076078398 10:127555969-127555991 GCAGTGATGAGAGAGGGCCCTGG + Intergenic
1076514351 10:131034880-131034902 ACACTGATGTTTGTGGCTCCAGG + Intergenic
1077130858 11:971758-971780 ACAGTGAAGTGAGTGGGACCGGG + Intronic
1078691918 11:13590333-13590355 GCAGTGATGATAGCAGGTCCTGG - Intergenic
1078977597 11:16495783-16495805 GCACTGGTGTTAGTGGATCTAGG - Intronic
1079068734 11:17323680-17323702 GCAGTGAAGCCATTGGGTCCTGG + Intronic
1082935170 11:58648439-58648461 GCAGTGAAGATACTAGGTCCTGG + Intronic
1084735843 11:71104733-71104755 GCAGTGCTGTTAGAGGGGCAGGG - Intronic
1086548024 11:88021467-88021489 GCAGTGAAGCCAATGGGTCCTGG - Intergenic
1086771299 11:90770521-90770543 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1087054001 11:93914724-93914746 GCATTGAAGTTATTAGGTCCTGG + Intergenic
1087227526 11:95618618-95618640 GCACTGGTGTTACTGGATCCAGG - Intergenic
1087368080 11:97247693-97247715 GCTCTGATGTTAGTGAGTCCTGG + Intergenic
1087370990 11:97283670-97283692 GAAGTGAAGTTATTGGGTCCTGG - Intergenic
1087690337 11:101314088-101314110 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
1087694218 11:101357092-101357114 GCAGTGAAGTCATTGAGTCCTGG - Intergenic
1090911883 11:131128710-131128732 GCACTGCTGCTACTGGGTCCAGG + Intergenic
1092497970 12:9016537-9016559 GCAGTGAAGCCACTGGGTCCTGG - Intergenic
1092871165 12:12807208-12807230 GCTGGGATGTTGGTGGTTCCTGG - Intronic
1093320954 12:17714347-17714369 GCAGTGAAGTTACTGGGTCCAGG + Intergenic
1094350123 12:29515266-29515288 GCAGTGGGGTCAGTGGGTGCTGG - Intronic
1094440859 12:30474888-30474910 GTAGTGAAGCTATTGGGTCCTGG - Intergenic
1097430515 12:59499616-59499638 GGAGTGGAGTTGGTGGGTCCAGG - Intergenic
1098735001 12:74090575-74090597 GCAGTGAAGTCAGCAGGTCCTGG - Intergenic
1099024832 12:77452237-77452259 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1099519376 12:83641942-83641964 GCACTGGTGTTAGTGGGTCCAGG + Intergenic
1100798913 12:98211137-98211159 GCAGTCATGTCTGTGGGCCCAGG - Intergenic
1101070128 12:101065642-101065664 GCAGTGAAGCAATTGGGTCCTGG - Intronic
1104588633 12:130067081-130067103 CCAGGGTTGTTAGTGGGGCCTGG + Intergenic
1106414071 13:29531354-29531376 GCAGTGCTGTCAGAGGTTCCTGG - Intronic
1106843881 13:33716637-33716659 GCACTGAAGCTATTGGGTCCTGG - Intergenic
1107551783 13:41483090-41483112 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
1107875568 13:44787962-44787984 GCAGGGTCGTTAGTGGGTACAGG - Intergenic
1108635373 13:52329116-52329138 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1108652436 13:52494113-52494135 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
1110377646 13:74812449-74812471 GCAGTGAAGCCACTGGGTCCTGG - Intergenic
1110486056 13:76044085-76044107 GCAGTGATGTAAGTCAGCCCTGG + Intergenic
1110486887 13:76056249-76056271 TCAGTGAAGCTATTGGGTCCTGG - Intergenic
1110665454 13:78112045-78112067 GCAGTGAAGCCACTGGGTCCTGG + Intergenic
1111380851 13:87449636-87449658 GCAGTGATGTAATTGGGTCCTGG - Intergenic
1111518531 13:89367089-89367111 GCAGTGTTGGAAGTGGGGCCTGG + Intergenic
1111568281 13:90045541-90045563 GCAGTGAAGTCAGTAGGTCTGGG + Intergenic
1111752934 13:92357807-92357829 GCAGGGATGTGATTGGGTCATGG - Intronic
1111816194 13:93156402-93156424 GCAGGGCTGCTAGGGGGTCCTGG + Intergenic
1112546827 13:100379374-100379396 ACACTGATGTTAGTGGGTCCAGG + Intronic
1113467206 13:110520694-110520716 GCAGTGGTGTCAGGGAGTCCTGG - Intergenic
1114783441 14:25566647-25566669 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
1115229894 14:31149052-31149074 ACAGTAAGTTTAGTGGGTCCTGG + Exonic
1115276075 14:31610448-31610470 GCAGTGAAGCTATTGGGTCGTGG - Intronic
1115695760 14:35897479-35897501 GCACTGGTGTTAGTGGGACCAGG + Intronic
1116369947 14:44117623-44117645 GCAATGCTGGTGGTGGGTCCTGG - Intergenic
1117744882 14:58859892-58859914 GCACTGGTGTTATTGTGTCCAGG + Intergenic
1118083835 14:62393517-62393539 GCATTGTTGTTAGTGGTTGCTGG + Intergenic
1118798118 14:69163378-69163400 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1120738129 14:88078152-88078174 GGTGTGATGTAAGTGGGCCCTGG + Intergenic
1122435923 14:101698357-101698379 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1123462818 15:20489282-20489304 GCAGTGAAGTCACTGGGTCCTGG + Intergenic
1123655241 15:22511137-22511159 GCAGTGAAGTCACTGGGTCCTGG - Intergenic
1123960725 15:25397087-25397109 TCAGTGAGGTGAGTGGGTCCAGG - Intronic
1124309151 15:28606338-28606360 GCAGTGAAGTCACTGGGTCCTGG - Intergenic
1126433218 15:48608986-48609008 GCAATGTTGTTAGTTGGTTCAGG + Intronic
1127410216 15:58697766-58697788 GCACTGGTGTTAGCAGGTCCAGG - Intronic
1128380674 15:67109798-67109820 TCAGTGATGTCAGTGGGCCATGG + Intronic
1129070593 15:72946878-72946900 GCATTGGTGTTAGCAGGTCCAGG - Intergenic
1131945293 15:97613489-97613511 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1132402162 15:101518645-101518667 GCAGTGATGCTATTAGGTCCTGG - Intronic
1132410948 15:101577970-101577992 GGAGTGAGGAGAGTGGGTCCGGG - Intergenic
1132510006 16:335336-335358 GCTGTGTTATTAGTGTGTCCTGG - Intronic
1134803448 16:17106149-17106171 GCAGACATGTTAGTGGGTGCAGG + Exonic
1137972539 16:53000505-53000527 GGAGGGAAGTCAGTGGGTCCAGG + Intergenic
1138915314 16:61456111-61456133 GCATCAGTGTTAGTGGGTCCAGG - Intergenic
1138916715 16:61473186-61473208 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1139530927 16:67542410-67542432 GTAGTGGTGTGAGTGGGGCCTGG - Exonic
1139631125 16:68232512-68232534 CCAGTGCTGTTAGTGCCTCCTGG + Intronic
1141213849 16:82005780-82005802 GCAGTCATTTTAGTGGATACAGG + Intronic
1141494948 16:84402892-84402914 GCAGTGAAGCCACTGGGTCCTGG + Intronic
1142382516 16:89741306-89741328 GAAGGGATTTTAGTGGCTCCAGG - Intronic
1143128335 17:4659279-4659301 GCAGTGCTATGCGTGGGTCCAGG - Intergenic
1143431263 17:6887431-6887453 GCAGTGAAGCCATTGGGTCCTGG + Intronic
1144701028 17:17340090-17340112 GCAGTGAAGCTATTGGGTCCCGG + Intronic
1144992665 17:19244502-19244524 GGAGTAATGTTGTTGGGTCCTGG + Intronic
1145054113 17:19687920-19687942 GCAGTGAAGTCATTGGGTCCTGG - Intronic
1149182101 17:53951340-53951362 GCCCTGCTGTTAATGGGTCCAGG - Intergenic
1152512342 17:80798838-80798860 GCAGAGCTGTCAGTGGGTGCTGG + Intronic
1152740232 17:82015493-82015515 GCAGTGCTGGTTGGGGGTCCTGG + Intronic
1153454845 18:5269970-5269992 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1153601790 18:6788093-6788115 GCAGTGCTGGTGGTGGGGCCTGG + Intronic
1155447062 18:25923226-25923248 GCAGAGCTGTTGGTGGGTGCTGG - Intergenic
1155534207 18:26799421-26799443 GCAGTGATGCCATTTGGTCCAGG - Intergenic
1156027302 18:32669760-32669782 GCACTGGTATTAGTGGGTCTAGG + Intergenic
1156535289 18:37857897-37857919 GCAGTGAAGCCACTGGGTCCTGG + Intergenic
1157089360 18:44618044-44618066 GCAGTGATGCCATTGTGTCCTGG - Intergenic
1158748137 18:60226313-60226335 CCAGTGGTGTTGGTGGGTCCAGG + Intergenic
1159111873 18:64069337-64069359 GCACTGGTGTTAGTGGGTTCAGG + Intergenic
1160141906 18:76331958-76331980 GCAGTGAAAGTATTGGGTCCTGG - Intergenic
1161061513 19:2217469-2217491 GCAGTGATGGATGTGGGCCCTGG + Intronic
1161568450 19:5016655-5016677 GCAGACAGGGTAGTGGGTCCTGG - Intronic
1162277385 19:9666901-9666923 GCAGTGAAGTTATCAGGTCCTGG - Intronic
1163789296 19:19297135-19297157 GCAGGGATGATAGTGGGCGCAGG + Exonic
1163874396 19:19854834-19854856 ACAGTGATGTGAGAGGTTCCAGG - Intergenic
1163900800 19:20098394-20098416 ACAGTGATGTGAGAGGCTCCAGG + Intronic
1163909887 19:20179791-20179813 ACAGTGATGTGAGAGGCTCCAGG + Intronic
1163926510 19:20349699-20349721 ACAGTGATGTGAGAGGATCCAGG - Intergenic
1163932887 19:20414684-20414706 ACAGTGATGTGAGAGGCTCCAGG - Intergenic
1163970344 19:20787634-20787656 ACAGTGATGTGAGAGGCTCCAGG + Intronic
1164140739 19:22460059-22460081 GCAGTTATGTGAGGGGCTCCAGG + Intronic
1166165430 19:40984413-40984435 GCAATGGTGTTAGTGGATCTAGG - Intergenic
1166256398 19:41607970-41607992 GCAGTGAAGTCATTCGGTCCTGG + Intronic
1167515462 19:49920911-49920933 GCAGTGATGTTGGTGGGGGAAGG + Intronic
1167986506 19:53322833-53322855 GCACCAATGTTAGTGAGTCCAGG + Intergenic
925232650 2:2248408-2248430 GCAGTGAAGCCATTGGGTCCTGG - Intronic
925776908 2:7344534-7344556 GCAGTTATGTTAGTGTTTCCAGG - Intergenic
926916249 2:17894770-17894792 GCAGTGATGTTAGCCGGCTCAGG - Intronic
928890226 2:36196085-36196107 GCTGTGTTCTTACTGGGTCCTGG + Intergenic
931661279 2:64565551-64565573 GCAATGCTGTTAGTGGATTCTGG + Intronic
933388481 2:81641395-81641417 GCAGTGAAGTCATTGGGTCCTGG - Intergenic
935133423 2:100278393-100278415 GCCCTGGGGTTAGTGGGTCCAGG - Exonic
935478302 2:103553266-103553288 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG + Intergenic
936818162 2:116485115-116485137 GCACTGGTGTTAGTGGATCCAGG - Intergenic
938279210 2:130052541-130052563 GGGGTCTTGTTAGTGGGTCCTGG - Intergenic
938330195 2:130443417-130443439 GGGGTCTTGTTAGTGGGTCCTGG - Intergenic
938359750 2:130678086-130678108 GGGGTCTTGTTAGTGGGTCCTGG + Intergenic
938436160 2:131284807-131284829 GGGGTCTTGTTAGTGGGTCCTGG + Intronic
939244472 2:139605871-139605893 GCAGTGACGTCATTGTGTCCTGG + Intergenic
941813553 2:169778118-169778140 GCAGTGAGGTTGGTGGGTTGAGG - Intergenic
941997320 2:171612571-171612593 GCTCTGATGTTAGTTAGTCCTGG - Intergenic
942376476 2:175343269-175343291 GTACTGGTGTTAGTGGGTCCAGG + Intergenic
944048656 2:195440875-195440897 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
944095725 2:195965574-195965596 GCAGTGAAGCCATTGGGTCCTGG + Intronic
944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG + Intronic
945461965 2:210119218-210119240 GCAGTGAAGCCATTGGGTCCTGG - Intronic
945866446 2:215181968-215181990 GCAATGGTGTTAGTGGGTTCTGG + Intergenic
946694064 2:222334004-222334026 GCACTGGTGTTAGTGGGTTCAGG - Intergenic
947130665 2:226920968-226920990 GCAGTGAAGCCATTGGGTCCAGG + Intronic
947209251 2:227692104-227692126 GCAGTGAAGCCATTGGGTCCTGG - Intronic
947401689 2:229736823-229736845 GCACTAGTGTTAGTGGGTTCAGG - Intergenic
1169504397 20:6193104-6193126 TTAGTGATGTTAGTGCGTCAGGG + Intergenic
1171364205 20:24612789-24612811 GCAGTGATGTTTCTAGATCCAGG - Intronic
1175534825 20:59702248-59702270 GAGGTGATGACAGTGGGTCCAGG - Intronic
1175747714 20:61471144-61471166 GCAGTGAAGCCAGTGGGTCCTGG + Intronic
1177632194 21:23743246-23743268 GAAGTGATGTAAGTGGGGCCGGG + Intergenic
1178411153 21:32364826-32364848 CCAGTGATGTGAGTGCATCCAGG - Intronic
1184467968 22:44680045-44680067 GCAGTGATGTCAGTCCCTCCTGG + Intronic
949809684 3:7992857-7992879 GCAGTGAAGCCATTGGGTCCCGG - Intergenic
951381880 3:21994979-21995001 GCAGTGATGTTAGTGGGTCCAGG + Intronic
952008514 3:28871807-28871829 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
953046655 3:39298781-39298803 ACACTGTTTTTAGTGGGTCCAGG - Intergenic
954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG + Intronic
956218218 3:66872324-66872346 GCAGTGTTGGCAGTGGGGCCTGG - Intergenic
956317791 3:67958187-67958209 GCAGTGAAGACATTGGGTCCTGG - Intergenic
959842010 3:110987929-110987951 GCAGTGACGCCATTGGGTCCTGG - Intergenic
960014477 3:112871456-112871478 ACACCAATGTTAGTGGGTCCAGG + Intergenic
960094927 3:113680208-113680230 GCAGTGAAGCTATTGGGTCCTGG + Intronic
960754413 3:120994883-120994905 GCAGTGAAGCCATTGGGTCCTGG + Intronic
961952719 3:130766960-130766982 GCAGTGAAGTCACTGGGTCCCGG - Intergenic
962237658 3:133720705-133720727 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
962483650 3:135820371-135820393 GCAGTGAAGCTATTGGGTCTTGG - Intergenic
964687152 3:159408668-159408690 GCAGTGAAGCCATTGGGTCCTGG - Intronic
965118039 3:164516399-164516421 GCAGTGAAGACATTGGGTCCTGG + Intergenic
965137659 3:164793285-164793307 TCAGTAATGTTAATGGTTCCTGG - Intergenic
965318389 3:167220116-167220138 GCAGTGAAGCTATTGTGTCCTGG - Intergenic
966468474 3:180260001-180260023 GCAGTGAAGCCAGTGGGTCCTGG - Intergenic
966499691 3:180625917-180625939 TCACTGGTGTTAGTGGATCCTGG + Intronic
970757501 4:19443752-19443774 GCACTGGTGTTAGTGAGTCCAGG - Intergenic
970915252 4:21325213-21325235 GCAGCGAAGCCAGTGGGTCCTGG + Intronic
971838189 4:31796873-31796895 GCAGTGAAGTCATTGCGTCCTGG + Intergenic
972641790 4:40932158-40932180 GCAGTGATGTATGTGGAGCCAGG - Intronic
973853111 4:54981542-54981564 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
974396402 4:61341407-61341429 GCAGTGAAGTTAGGGGTTCGAGG - Intronic
974465105 4:62245284-62245306 TCAGTGATGCTAGAGGCTCCTGG - Intergenic
975027120 4:69563730-69563752 ACAGTGAAGTGATTGGGTCCTGG - Intergenic
975674910 4:76817140-76817162 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
976289891 4:83406831-83406853 GCAGTGAAGTGTGTGGGTGCTGG + Intergenic
976943461 4:90735430-90735452 GCAGTGAAGCCACTGGGTCCTGG + Intronic
978035786 4:103992086-103992108 GCAGTGAAGCCAGTGGATCCTGG + Intergenic
978422415 4:108546814-108546836 GCACTGGTGTTATTGGGTCCAGG - Intergenic
978613730 4:110572204-110572226 GCACTGGTGTCAGTGGGCCCTGG - Intergenic
979757236 4:124356636-124356658 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
979781083 4:124651728-124651750 GCAGTGGTGTAAGCGCGTCCGGG - Intergenic
981262830 4:142742299-142742321 GCAGAGATGCTTGTGGGACCAGG + Intronic
981287112 4:143030824-143030846 GCAGTGAAGCTATTGGGTTCTGG - Intergenic
981837274 4:149068908-149068930 GCAGTGAAGTCATTGGGTGCTGG - Intergenic
982170449 4:152656300-152656322 GCACTGGTGTTAGTGTGTCCAGG - Intronic
983010598 4:162540703-162540725 CCAGTGATGGAAGTGGGGCCTGG - Intergenic
983254016 4:165378783-165378805 GCAGTGACGTGGGTGGGTCATGG + Intronic
983389228 4:167107036-167107058 GCAGTGAAGCCAGTGGGTCCTGG - Intronic
983593718 4:169442149-169442171 GCACTGGTGATAGTGGGTCCAGG - Intronic
983808161 4:172020691-172020713 GCAGTGAAGCTATTGTGTCCTGG - Intronic
983949826 4:173627165-173627187 GCACTGATGTTAGCAGGTCCAGG + Intergenic
985751549 5:1681555-1681577 ACACTAGTGTTAGTGGGTCCAGG + Intergenic
986694374 5:10338990-10339012 GGAGGGAAGTTGGTGGGTCCTGG + Intergenic
986834494 5:11620307-11620329 GCAGTGATGTGATTGGGCACTGG - Intronic
987007421 5:13724634-13724656 CCAGTGATGAAAGTGGGGCCTGG + Intronic
988939698 5:36130871-36130893 GCAGTGAAGCCATTGGGTCCTGG - Intronic
989515463 5:42337679-42337701 GCACAGGTGTTAATGGGTCCAGG - Intergenic
989970387 5:50517342-50517364 GCAGTGAAGTCATTGGGTCCTGG + Intergenic
990400280 5:55430293-55430315 GCACTGATGTTAGAGGGTCCAGG - Intronic
990737521 5:58880213-58880235 GGAGAGAAGTAAGTGGGTCCAGG - Intergenic
991292310 5:65044828-65044850 TCAGTGATGGTGGTGGGTGCTGG - Intergenic
992840425 5:80685279-80685301 GCAGTGAAGCTATTGGGTCCTGG + Intronic
992934830 5:81691593-81691615 GCAGTGAAGTTAATGGGTCCTGG - Intronic
993175850 5:84483996-84484018 GGTGTGATGTTAGTGCATCCTGG + Intergenic
993193291 5:84705571-84705593 GCAGTGAAGGCATTGGGTCCTGG - Intergenic
993634836 5:90331374-90331396 GCTCTGGTGTCAGTGGGTCCTGG + Intergenic
994029075 5:95120214-95120236 GCAGTGAAGCTACTGAGTCCTGG - Intronic
994229077 5:97292532-97292554 GCAGTGAAGTCATTCGGTCCTGG + Intergenic
994254024 5:97571299-97571321 GGAGGGAGGTGAGTGGGTCCTGG - Intergenic
994293084 5:98052976-98052998 TCGGTGAAGTTATTGGGTCCTGG - Intergenic
994314190 5:98313216-98313238 TCAGTGTTGTAAGTGGGGCCTGG + Intergenic
994792735 5:104251403-104251425 GCAGTGAAGTCATTGGGTCCGGG + Intergenic
994845404 5:104982577-104982599 GCAGTGAAGGTTTTGGGTCCAGG + Intergenic
995991813 5:118248169-118248191 GCTCTAGTGTTAGTGGGTCCAGG - Intergenic
997184244 5:131865973-131865995 GCATTGGTGTTAGTGGATCCAGG + Intronic
997782009 5:136668098-136668120 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
1001745573 5:174089923-174089945 GATGAGATGTTAGTGGGGCCTGG + Intronic
1002677842 5:180933823-180933845 TCAGTGATGTCACTGGGTCCTGG - Intronic
1002715616 5:181224754-181224776 GCTGTGCTGTTTGTGGCTCCTGG - Exonic
1002720720 5:181260037-181260059 GCTGTGCTGTTTGTGGCTCCTGG + Exonic
1003606877 6:7570351-7570373 GCAGTGGTGTGAGCGTGTCCAGG + Intronic
1006553721 6:34847415-34847437 GCAGTGAAGCTATTGGGTCCTGG + Intronic
1008686438 6:53930662-53930684 GCAGTGATGTTGTAGGTTCCAGG - Intronic
1008707135 6:54176347-54176369 GCAGTGAAGCCACTGGGTCCCGG + Intronic
1008820178 6:55622870-55622892 GCAGTGAAGGCATTGGGTCCTGG + Intergenic
1009266181 6:61557749-61557771 GCAGTGAAGCTATTGGGTCCTGG + Intergenic
1009352844 6:62704100-62704122 GCAGTGAAGTCATTAGGTCCTGG + Intergenic
1009978168 6:70695885-70695907 GCAGTGAAGCCATTGGGTCCTGG + Intronic
1012288105 6:97417957-97417979 GCAGTGAAGTCATTGGGTCCTGG + Intergenic
1015144061 6:129966174-129966196 GCAGTGATGTCATCAGGTCCTGG + Intergenic
1016116477 6:140291304-140291326 GCAGTGGTGTTAGCAGGTACAGG - Intergenic
1016230105 6:141793045-141793067 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1016425816 6:143934882-143934904 GCACTGGTGTTAGCAGGTCCAGG + Intronic
1016728683 6:147404740-147404762 GCAGTGAAGCCATTGGGTCCAGG + Intergenic
1016869057 6:148798657-148798679 ACAGTGATGTTATGGGGGCCAGG + Intronic
1016934508 6:149439714-149439736 GCTGTGATTTCACTGGGTCCTGG + Intergenic
1017384040 6:153861882-153861904 GCACTGGTGTTAGTGAGTCCAGG - Intergenic
1018348742 6:162932493-162932515 GCAGTGAAGCAACTGGGTCCTGG + Intronic
1020787984 7:12592908-12592930 GCAGTGATGGCAGTGGGGGCCGG + Intronic
1022870288 7:34471391-34471413 GCACTGATGTTTGTGGGTCCAGG + Intergenic
1023460202 7:40387787-40387809 GGAATAATGTTAATGGGTCCAGG + Intronic
1027405031 7:77851215-77851237 GCAGTGAAGCCATTGGGTCCTGG + Intronic
1028037431 7:86002916-86002938 GCACTGATGTGAGTGGGTGCAGG + Intergenic
1028745559 7:94322291-94322313 ACAGTGAAGTGAGTTGGTCCAGG - Intergenic
1031231326 7:119110770-119110792 GCAGTGAAGTCACTGGGTCCTGG + Intergenic
1031566316 7:123301684-123301706 GCATTGAAGCTATTGGGTCCTGG - Intergenic
1031826119 7:126567813-126567835 GCAAGGATGATGGTGGGTCCAGG - Intronic
1031892578 7:127311839-127311861 GCAGTGAAGTTATTAGGTCCAGG - Intergenic
1032198789 7:129804942-129804964 GCACTGATGTTCTGGGGTCCTGG + Intergenic
1033183717 7:139205721-139205743 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1033626785 7:143118025-143118047 GCAGTGGGATTGGTGGGTCCAGG + Intergenic
1035268922 7:157708461-157708483 GCAGTGGTGTGAGTGGCTCTCGG + Intronic
1035551051 8:525912-525934 GCAGTGAAGCCATTGGGTCCTGG + Intronic
1036280376 8:7395296-7395318 ACAGTGCTGTCAGTGGTTCCTGG - Intergenic
1036341093 8:7916274-7916296 ACAGTGCTGTCAGTGGTTCCTGG + Intergenic
1037127340 8:15366952-15366974 GCAGTGATGGTAGTGTGACCTGG + Intergenic
1037381366 8:18288383-18288405 GCAGTGATGCTAGTGTGCCCTGG - Intergenic
1037763153 8:21755656-21755678 GCAGTGATGTCACTGCTTCCAGG - Intronic
1038689500 8:29748278-29748300 GCAGTGATGGAGGTGGGGCCTGG - Intergenic
1038812852 8:30868717-30868739 ACAGTGATCTTAGTGGTTCACGG - Intronic
1039064473 8:33597189-33597211 GCAGTGGTGTCATTGGTTCCTGG - Intronic
1039390373 8:37175848-37175870 CCAGTGATGGAAGTGGGACCTGG - Intergenic
1041422547 8:57684612-57684634 GCAGTGATGTCATCTGGTCCTGG - Intergenic
1041782868 8:61596470-61596492 GCACTGATGGTAGTGGGTCCAGG - Intronic
1042649402 8:71023547-71023569 GCACTGGTGTTAGTGGGCCCAGG + Intergenic
1043005007 8:74808307-74808329 GGAATGAGGTTGGTGGGTCCAGG - Intronic
1043015602 8:74936588-74936610 GCAGTGACGTCATTGGGTCCTGG + Intergenic
1043036023 8:75200624-75200646 GCAGTGATGTCATCTGGTCCTGG + Intergenic
1043235613 8:77862040-77862062 GCAGTGAAGCCACTGGGTCCTGG - Intergenic
1047253497 8:123198288-123198310 GCAATGCAGCTAGTGGGTCCTGG - Intronic
1049569634 8:143363076-143363098 GCAGTACTGTTTGTGGGGCCAGG - Intergenic
1050380105 9:5019975-5019997 GTAATGGTGTTAGTGGGTCCAGG + Intronic
1050390048 9:5133150-5133172 GCAGTGATATTAGAGTGTCATGG + Intronic
1050505467 9:6343900-6343922 GCAGTGAAGCCACTGGGTCCTGG - Intergenic
1050510270 9:6387248-6387270 GCAGTGAAGCTATTGGATCCTGG - Intergenic
1050607151 9:7314234-7314256 GCAATGGTGTTAGTGGGTCCAGG + Intergenic
1050807253 9:9696001-9696023 GCAGTGAAGTCATTAGGTCCTGG + Intronic
1051107981 9:13603128-13603150 GCACTGGTATTAGTGGGCCCAGG + Intergenic
1051573753 9:18590141-18590163 GCAGTGAAGTCATTGGGTCCTGG + Intronic
1051766184 9:20526335-20526357 GTAGTAATGTTAGTGGGTACTGG - Intronic
1052903123 9:33811976-33811998 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1053046460 9:34923436-34923458 GCAGTGAAGCCATTGGGTCCAGG + Intergenic
1055038735 9:71846024-71846046 GCAGGGATGTTATTGAGACCAGG + Intergenic
1055563154 9:77542470-77542492 GCTCTGGTGTTAGTGGGTCTAGG + Intronic
1056517052 9:87363442-87363464 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1056556448 9:87694006-87694028 GTACTGATACTAGTGGGTCCAGG + Intronic
1058406300 9:104678767-104678789 GCAGTGAAGACATTGGGTCCTGG - Intergenic
1058558155 9:106192630-106192652 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
1059617439 9:115966694-115966716 CCAGTGTTGTAGGTGGGTCCTGG - Intergenic
1060523075 9:124305208-124305230 GCAGTGATGCTAGTTGGTTAAGG + Intronic
1062281489 9:135753886-135753908 GCAGTGGTGCTAGAGGGGCCAGG + Intronic
1186028838 X:5345293-5345315 GGAGTGATTTTAGAGAGTCCAGG + Intergenic
1187088839 X:16072015-16072037 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
1187628260 X:21141354-21141376 GCACTGATGGTAGCAGGTCCAGG + Intergenic
1188663672 X:32791351-32791373 GCATTGATGTTAGTGTGTCCAGG - Intronic
1189065606 X:37805061-37805083 GTGGTGATGTTAGTGGGAGCAGG + Exonic
1189220090 X:39364134-39364156 CCAGTGTTGGAAGTGGGTCCTGG + Intergenic
1189871611 X:45389840-45389862 GCAGTGAAGTTATGAGGTCCTGG + Intergenic
1190517507 X:51239666-51239688 GCAGTGAAGTCATTCGGTCCTGG - Intergenic
1190517811 X:51243180-51243202 GCAGTGGTGTCAGTGGGTCCAGG + Intergenic
1190930595 X:54946549-54946571 GCAGAGATGTTTGTGGGTTGGGG - Intronic
1191703988 X:64073774-64073796 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1191778685 X:64845003-64845025 GCAGTGATGGCAGAGGGTGCTGG - Intergenic
1191949913 X:66578322-66578344 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
1192070261 X:67931920-67931942 GCAGTGAAGCCATTGGGTCCTGG - Intergenic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1193098697 X:77582876-77582898 GCAGTGAAGCTATTGGGTCCTGG - Intronic
1193204539 X:78732563-78732585 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
1193296070 X:79831811-79831833 GCACTGGTGTTAGTGGGTCTGGG - Intergenic
1194024086 X:88729872-88729894 GCAGTGAAGTAATTGGGTCCTGG - Intergenic
1194097818 X:89665558-89665580 GCATTGGTGTTAGTGGGTTTAGG + Intergenic
1194434043 X:93848620-93848642 GCATTGTTGTTAGCAGGTCCAGG + Intergenic
1194561794 X:95430785-95430807 CCAGTGAAGCCAGTGGGTCCTGG - Intergenic
1195805016 X:108755057-108755079 GCAGTGAAGCCATTGGGTCCTGG + Intergenic
1195824685 X:108985969-108985991 GCAGTGAAGTCATTGGGTCCTGG + Intergenic
1195900967 X:109796871-109796893 GCTGTGGTGTTAGTGTGTACTGG + Intergenic
1196574906 X:117305717-117305739 GCACTAGTGTTAGTGGGTCCAGG - Intergenic
1196599661 X:117587261-117587283 GCAGTGAAGTCACTGGGTCCTGG + Intergenic
1196614080 X:117747655-117747677 GCAGTGAAGCCACTGGGTCCTGG - Intergenic
1196835872 X:119813268-119813290 CCAGTGTTGTAGGTGGGTCCTGG + Intergenic
1196986688 X:121281770-121281792 ACACTCATGTTAGTGGGTCCTGG + Intergenic
1197270993 X:124424669-124424691 CCAGTGTTGGAAGTGGGTCCTGG + Intronic
1197411631 X:126123564-126123586 GCTCTGATGTTAGTGGGTCCTGG + Intergenic
1197670219 X:129268895-129268917 GCAGTGAAGCCACTGGGTCCCGG + Intergenic
1198279403 X:135126844-135126866 GCAGTGATGGGAGTGGGGCTGGG + Intergenic
1198291553 X:135245670-135245692 GCAGTGATGGGAGTGGGGCTGGG - Intergenic
1199104310 X:143844189-143844211 GCAGTGATGCCATTAGGTCCTGG + Intergenic
1199223397 X:145343314-145343336 CCAGTGTTGAAAGTGGGTCCTGG - Intergenic
1199304292 X:146249307-146249329 GCAGTGAAGTCATCGGGTCCTGG - Intergenic
1200450838 Y:3326946-3326968 GCATTGGTGTTAGTGGGTTTAGG + Intergenic
1200743229 Y:6877702-6877724 GCACCAATGTTACTGGGTCCTGG - Intergenic
1201567168 Y:15377781-15377803 CCAGTGATGCCAGTTGGTCCTGG - Intergenic
1202042443 Y:20699342-20699364 GCACTAATGTTAGTGGGTCTAGG + Intergenic