ID: 951384575

View in Genome Browser
Species Human (GRCh38)
Location 3:22027899-22027921
Sequence TATGCAGGCACTACCAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 2, 2: 3, 3: 14, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951384573_951384575 3 Left 951384573 3:22027873-22027895 CCTGGTTCACAGATGGTTCTGCA 0: 145
1: 202
2: 166
3: 154
4: 279
Right 951384575 3:22027899-22027921 TATGCAGGCACTACCAAAAGTGG 0: 1
1: 2
2: 3
3: 14
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951384575 Original CRISPR TATGCAGGCACTACCAAAAG TGG Intronic
901136833 1:7002797-7002819 AATGCAGGTTCTATCAAAAGAGG + Intronic
908944936 1:69483999-69484021 TATCACGGCACTACCAAAAAGGG - Intergenic
909331408 1:74416300-74416322 ATTGTAGGCACTACCAAAAAGGG + Intronic
911631138 1:100184824-100184846 TATAAAGATACTACCAAAAGAGG - Intergenic
912212302 1:107569296-107569318 TATGCAGGCATCACCCAAAGTGG + Intergenic
912251978 1:108020983-108021005 TATTCAGGTACCACCCAAAGTGG - Intergenic
921344629 1:214169775-214169797 TCTGCAGGCTGTACAAAAAGTGG + Intergenic
924490932 1:244536615-244536637 TATGCAGCCACTACCGAGATGGG + Intronic
1068520273 10:58069892-58069914 TATCCAGGCCATCCCAAAAGTGG - Intergenic
1071792634 10:88971747-88971769 TATGCAGGAAGGACAAAAAGAGG - Intronic
1073382221 10:103087509-103087531 TATGGATGCAATACAAAAAGTGG + Exonic
1076530922 10:131143591-131143613 TCTGCCGTCACTACCAAGAGAGG + Intronic
1079973689 11:27066415-27066437 TATATAGGCACTAGCAAAATTGG - Intronic
1081237211 11:40659751-40659773 TCTGCAGGCAAGACCCAAAGTGG - Intronic
1082307077 11:50592393-50592415 TATGCAGACCCTACCAAAACAGG - Intergenic
1083403107 11:62438141-62438163 TGACCAGGCACTAACAAAAGAGG - Intronic
1087467067 11:98522214-98522236 TTTGAAGGCACCACCAAAACAGG - Intergenic
1088097260 11:106115536-106115558 TATGCGGGCACCACCTGAAGTGG + Intergenic
1088191605 11:107234117-107234139 TATTCAGGCACCACCCAAAGTGG - Intergenic
1088623220 11:111708237-111708259 TAAGCACGCACTACCATAACCGG - Intronic
1091267829 11:134284377-134284399 TGTGCAGGCACTAAAAAGAGTGG - Intronic
1091785157 12:3238937-3238959 CATGCAGGCCCTCCCAAAGGAGG + Intronic
1092948805 12:13481160-13481182 TATGCATGCACTGCCACAAAAGG - Intergenic
1095056860 12:37618028-37618050 TTTGCAGATACTACAAAAAGAGG - Intergenic
1095060194 12:37678484-37678506 TTTGCAGATACTACAAAAAGGGG + Intergenic
1098094636 12:66941959-66941981 GTTGCAGGCACTACCCATAGAGG + Intergenic
1098847900 12:75560956-75560978 CATGCAGGTAAAACCAAAAGGGG - Intergenic
1101087480 12:101251178-101251200 AATGAAGGCACTTCAAAAAGAGG + Intergenic
1101344013 12:103868323-103868345 TCTGAAGGCACTTCCAAAAGAGG - Intergenic
1101697362 12:107139148-107139170 TATGCAGGCACCACCGGAAAGGG - Intergenic
1102355667 12:112233118-112233140 CTTACAGGCACTGCCAAAAGTGG + Intronic
1102784118 12:115590236-115590258 TGGACAGGCACTACCAGAAGTGG - Intergenic
1103230708 12:119328189-119328211 TATCCAGGAAGTACCAGAAGGGG + Intergenic
1106467568 13:30026453-30026475 AGTGCAGGCACTAGCAACAGTGG + Intergenic
1107654233 13:42574833-42574855 TATGCAATCACTACCAGAAAAGG - Intronic
1109268672 13:60229701-60229723 TAGAAAGGCACTCCCAAAAGAGG - Intergenic
1112594807 13:100797752-100797774 TATTCAGGAACTACTACAAGAGG - Intergenic
1112661650 13:101516588-101516610 TATCCAGTCACTATCAAAATTGG - Intronic
1115079959 14:29438146-29438168 TTTGTAGGCACTTCCAAAGGAGG - Intergenic
1115720241 14:36152950-36152972 TTAGCAGGCACTTCCAAAAGAGG + Intergenic
1117542729 14:56764124-56764146 TAGGCATGCACTACCACACGTGG + Intergenic
1117832599 14:59767364-59767386 GATGAAGGCAATACCCAAAGGGG + Intronic
1117925161 14:60771338-60771360 TATACAGGCATTAACAGAAGAGG - Intronic
1118742830 14:68752980-68753002 TGTGAAGGCACTTCCAAAAGGGG + Intergenic
1121264067 14:92587703-92587725 CTTGCAGTCACTTCCAAAAGAGG - Intronic
1202861446 14_GL000225v1_random:85052-85074 TATCTAGGCTCTTCCAAAAGGGG + Intergenic
1131340133 15:91591193-91591215 AACCCAGGCACTAACAAAAGTGG + Intergenic
1138545246 16:57715188-57715210 CAGGCATGCACTACCACAAGTGG + Intronic
1139637998 16:68270469-68270491 TAAGCCAGCACTACCAAGAGCGG + Intronic
1140984843 16:80148394-80148416 TATGGAGGCACTACCCTCAGTGG + Intergenic
1144413523 17:15023904-15023926 TATGCAGGGGCACCCAAAAGGGG - Intergenic
1145683802 17:26633153-26633175 TTTGCAGACTCTACAAAAAGAGG - Intergenic
1147413616 17:40272419-40272441 TTTGGAGGCAATTCCAAAAGAGG + Intronic
1149080435 17:52650111-52650133 TATGAGGGCTCTCCCAAAAGTGG + Intergenic
1155913170 18:31528565-31528587 TAGGCATGCACTACCAAACCTGG - Intronic
1156606419 18:38672139-38672161 TATGCAGGCACCACTGAGAGTGG + Intergenic
1157749308 18:50163814-50163836 TTTGCTGGCAGTAACAAAAGAGG + Intronic
1161932081 19:7347671-7347693 CAGGCAGGCACCACCAAATGTGG + Intergenic
1164331482 19:24262604-24262626 TGTGCAGATTCTACCAAAAGAGG + Intergenic
1164348416 19:27298001-27298023 TTTGCAGATACTACAAAAAGAGG - Intergenic
1164369085 19:27625876-27625898 TTTGCAGATTCTACCAAAAGAGG - Intergenic
1164830114 19:31313803-31313825 TAGCCATGCACTACCAGAAGTGG + Intronic
935225985 2:101053686-101053708 TATGCAGTCGCTTCCAGAAGGGG - Intronic
939202347 2:139053546-139053568 TATTCAGGCCCTACCCAAAGTGG - Intergenic
939755319 2:146102531-146102553 TACACAGGCACTATCCAAAGTGG + Intergenic
947298613 2:228663030-228663052 TATGCTAGCACTAACAATAGCGG - Intergenic
1169566543 20:6859316-6859338 AGTTCAGGCAATACCAAAAGTGG + Intergenic
1171717932 20:28512664-28512686 CTTGCAGACACTACAAAAAGAGG - Intergenic
1171728001 20:28644300-28644322 CTTGCAGACACTACAAAAAGAGG + Intergenic
1177685952 21:24437669-24437691 TATGCATCCACTAGCAAAAAAGG + Intergenic
1177791412 21:25726076-25726098 TATGAAGGTTCTACCAAACGAGG + Intronic
1178838966 21:36123242-36123264 TATGAAGCCACTAACAAAGGAGG + Intergenic
1179126722 21:38597654-38597676 TCAGCAGGCACTTCCCAAAGAGG + Intronic
1179519000 21:41929961-41929983 AAAGCAGGCACTTTCAAAAGGGG + Intronic
1180133899 21:45848052-45848074 TATGCAGTCATTACCAGTAGAGG + Intronic
1180591095 22:16937990-16938012 TATTCAGGCACCACCAAAAGCGG - Intergenic
949245922 3:1925301-1925323 TATGCAGGCACCACCCAAAGGGG + Intergenic
951384575 3:22027899-22027921 TATGCAGGCACTACCAAAAGTGG + Intronic
951409695 3:22347688-22347710 TATGCATGCCCTAACAATAGAGG + Intronic
951548604 3:23854113-23854135 TAGGCATGCACTACCACAATCGG - Intronic
951675636 3:25238213-25238235 TATGTAGGAACTAAAAAAAGTGG - Intronic
953376809 3:42435734-42435756 TATCCAGGCAGTAGGAAAAGAGG + Intergenic
957298456 3:78361272-78361294 TATGCAGGCACCACCAAAAGTGG - Intergenic
957568307 3:81912765-81912787 TATACAGGCAAAACCAAGAGAGG - Intergenic
959026857 3:101249160-101249182 TATGCAGAGACTAACAACAGTGG - Intronic
959897433 3:111620353-111620375 TATGCAGGGAGTATCAAGAGAGG + Intronic
965410724 3:168327200-168327222 AATACAGCAACTACCAAAAGTGG - Intergenic
970002134 4:11374808-11374830 TATGCAGACACCACCAAATGTGG + Intergenic
971319798 4:25596272-25596294 TATTCATGCACTAGCAAATGTGG + Intergenic
972518379 4:39830856-39830878 TTTGCATGTACTACCAAAAGAGG + Intronic
974364560 4:60929347-60929369 TAGGCAGGCACTACCATACCTGG - Intergenic
986097070 5:4568822-4568844 TATGCAGGCAGTATCATCAGTGG + Intergenic
986569032 5:9146244-9146266 GGTGCTGGCACTAACAAAAGTGG - Intronic
988562182 5:32291214-32291236 CATGCAGGCACCACCAAAAGTGG + Intronic
989861285 5:46379374-46379396 TTTGCAGACACTACAAAAAGAGG - Intergenic
989946292 5:50233774-50233796 TTTGCAGATACTACAAAAAGAGG + Intergenic
989947072 5:50249855-50249877 TTTGCAGATACTACAAAAAGAGG + Intergenic
991569538 5:68040011-68040033 TATGCAGGCACTACCATGCCCGG - Intergenic
993971298 5:94422939-94422961 TTTCCCGGCACTAACAAAAGAGG + Intronic
994451771 5:99952095-99952117 TATGCAGGCACTTAGAGAAGTGG - Intergenic
995017473 5:107327294-107327316 TTTCAAGGTACTACCAAAAGAGG - Intergenic
1001944935 5:175770916-175770938 GACCCAGGCACTACCAAAGGGGG - Intergenic
1005356621 6:24990363-24990385 TAAGAAGTCAATACCAAAAGAGG + Intronic
1005777471 6:29151471-29151493 TATGCAGGAGCTAAAAAAAGTGG - Intergenic
1010050617 6:71499829-71499851 TTTGAAGGCAATTCCAAAAGAGG + Intergenic
1012820849 6:104083295-104083317 TATGCAGGCACCACTGAAAGTGG + Intergenic
1013915421 6:115331988-115332010 AAAGCAGGCACTATTAAAAGGGG + Intergenic
1015687320 6:135879510-135879532 TCTGCAGGACCTACAAAAAGTGG + Intronic
1019846294 7:3505703-3505725 TCTGCATCCACAACCAAAAGTGG + Intronic
1020714342 7:11651020-11651042 TAAGCAAACACTACCAAAAGTGG + Intronic
1022078937 7:27000706-27000728 TATGCAGGCACCACCCTAAAGGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1027560743 7:79726220-79726242 TATGCATTCATTACCAAAAATGG + Intergenic
1031365297 7:120893786-120893808 TAAGCAGATACTACCAAAACTGG + Intergenic
1031831225 7:126628350-126628372 TTTGCAGGCAATAGGAAAAGAGG - Intronic
1034357213 7:150460600-150460622 TATGCAGGCACTACCCAAAGTGG - Intronic
1037873541 8:22523621-22523643 TCTGAAGGCAATGCCAAAAGAGG - Intronic
1037873564 8:22523854-22523876 TCTGGAGGCACTTCCAAAAGAGG + Intronic
1039432481 8:37535704-37535726 TATGCAGGGAGTCCCAAATGGGG - Intergenic
1047297638 8:123585383-123585405 TCTGGAGAAACTACCAAAAGGGG - Intergenic
1048709785 8:137196273-137196295 TATGCAGACTTTACCACAAGAGG + Intergenic
1050572476 9:6955518-6955540 TATGCAGGCAACACAATAAGAGG - Intronic
1051065416 9:13096306-13096328 TCTGCAGACATTACCAAAACTGG - Intergenic
1051359210 9:16266912-16266934 CATGGAGGAACTACCAAATGTGG + Intronic
1053238767 9:36479112-36479134 TCTGGAGACAGTACCAAAAGTGG - Intronic
1056974465 9:91238534-91238556 TTAGCAGACACTACCACAAGTGG + Intronic
1058042675 9:100321023-100321045 TCTGTAAGCACTACCTAAAGAGG + Intronic
1059361637 9:113746840-113746862 TTTTCAGGCACTCCCAATAGAGG - Intergenic
1192220090 X:69191950-69191972 TATGCAGGCTCTGCCAGAGGAGG - Intergenic
1194649666 X:96499870-96499892 AATGCAGGCAGGACAAAAAGTGG + Intergenic
1194884527 X:99296626-99296648 AATGTAGGCAATAACAAAAGTGG - Intergenic
1195544997 X:106104286-106104308 GATGAAGGGACTACCAAAACAGG + Intergenic
1199021294 X:142881484-142881506 TATGCAGGCACCACCTCAAAGGG + Intergenic
1201554418 Y:15253929-15253951 TAAGCAGGCAATCCCAAAAGGGG + Intergenic
1201560738 Y:15313725-15313747 TAGGCAGGCACTACCACACTTGG + Intergenic