ID: 951385851

View in Genome Browser
Species Human (GRCh38)
Location 3:22041500-22041522
Sequence TTTAAAATACAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 764}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951385849_951385851 19 Left 951385849 3:22041458-22041480 CCACAATTAAAATGCTTATCGAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 63
4: 764

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951385851 Original CRISPR TTTAAAATACAGAATGTGGA AGG Intronic
900002157 1:20591-20613 GTATAAATACAGAAGGTGGAGGG + Intergenic
900021878 1:191114-191136 GTATAAATACAGAAGGTGGAGGG + Intergenic
900848130 1:5120204-5120226 TTTAAAAAACAAAATGAGCAGGG + Intergenic
901113538 1:6819121-6819143 TTTTAAATATAAAATGTTGAGGG + Intronic
901819210 1:11815689-11815711 TTCAAAATGCAGAATCTGGCTGG - Intronic
903200114 1:21730025-21730047 TTTAAAAAATAGAATGTGGCAGG - Intronic
903572012 1:24313022-24313044 TCTAAAGTACAGAATGTAAAAGG + Intergenic
903844234 1:26267970-26267992 TGTAAAATACAGAATTTGTCTGG - Intronic
904650327 1:32000815-32000837 TTAAAAATACAAAATGTAGCTGG - Intergenic
904979541 1:34485731-34485753 TATAAAAGAAAGAAAGTGGATGG + Intergenic
906765230 1:48424006-48424028 TTTAAAATAAAGAATGTAATTGG - Intronic
907043151 1:51281472-51281494 TTTAAAACTCAGACTGTGGCAGG + Intergenic
907340847 1:53735231-53735253 TTTAAAATGCTGAATGTGAAGGG - Intergenic
908364789 1:63409830-63409852 CTTAAATGTCAGAATGTGGAGGG + Intronic
909181981 1:72435907-72435929 TTTAAAATAAAGAGTGTGACTGG - Intergenic
909495717 1:76275747-76275769 TTTAAAATACATAATACAGAAGG - Intronic
909748917 1:79134671-79134693 CTAAAAATACAAAATGTGGCCGG + Intergenic
909945151 1:81655294-81655316 TTAAAAATACAGAATGAGGCCGG - Intronic
910057833 1:83052708-83052730 TTTCAAATAGAGAAAGGGGAAGG - Intergenic
910204718 1:84737675-84737697 TTTAAGTCACAGCATGTGGAGGG + Intergenic
911267445 1:95759999-95760021 TTTAAAAAACTGAGTGTAGAAGG + Intergenic
911425041 1:97698672-97698694 TACAAAATAAAGAATTTGGATGG - Intronic
911887213 1:103318792-103318814 TTTAAAATACCAAAAGTGAAAGG + Intergenic
912134475 1:106643596-106643618 TTTTAAAGACAGAATGAGGCTGG + Intergenic
912578857 1:110702169-110702191 CTGAAAATACAGAATTTAGAAGG - Intergenic
912982549 1:114389010-114389032 ATTGAAATACAGTATGTGTAAGG - Intergenic
913241175 1:116831142-116831164 GTTAAAACACAGATTGTGGCCGG + Intergenic
914539215 1:148594857-148594879 CTAAAAATACAAAAAGTGGATGG - Intronic
915395585 1:155581275-155581297 TTTTAAATAAAGACTGTGGTTGG + Intergenic
916051046 1:161037372-161037394 TTTTTAATTCAGAATATGGAGGG - Intronic
916213047 1:162373896-162373918 TTTAAAAGAGAGAAAGGGGAGGG + Exonic
916686401 1:167151368-167151390 TTTAAAAGAAACAAGGTGGAAGG + Intergenic
918902528 1:190443072-190443094 CTAAAAATACAAAATGTAGACGG - Intronic
919133323 1:193477705-193477727 TTTACAATACAGAAGAGGGAAGG + Intergenic
919302938 1:195792861-195792883 TTTAAAATTCAAAATGGGTAAGG + Intergenic
919418231 1:197338223-197338245 TATAAAATATAGAAAGTGTAGGG + Intronic
919500216 1:198329048-198329070 TTTAAAAGACAGAAAAGGGAAGG + Intergenic
919649684 1:200135068-200135090 TTTATAATACAAAATGTGACTGG + Intronic
920103126 1:203530557-203530579 TTTAAAACACAGATTGGGGTAGG - Intergenic
921455900 1:215371119-215371141 TATAAAACACAGAATGGGTATGG - Intergenic
921676805 1:217985157-217985179 TATAAAACTCAGAATGTGAAGGG + Intergenic
921711246 1:218375754-218375776 TTTAAAATACGGGATATTGAGGG + Intronic
922006785 1:221539228-221539250 TTTAATATACAAATTGTGGAGGG - Intergenic
922369952 1:224899981-224900003 TTTAAAATATACACTTTGGAGGG + Intronic
923128402 1:231053285-231053307 TGTAAAACACAGACTGTGGCCGG - Intergenic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
1062869331 10:886050-886072 TTTAAAAAACAGAAAATTGAAGG + Intronic
1063078252 10:2738510-2738532 TTTTAAAAATAGAAAGTGGAAGG + Intergenic
1063548451 10:7004979-7005001 TTTAAAATCCAGAATCTACAAGG + Intergenic
1063797729 10:9532044-9532066 ATTAAAACACATACTGTGGAAGG + Intergenic
1063898814 10:10710804-10710826 TTTAAAAAAGAAAATGAGGAGGG - Intergenic
1064268106 10:13841257-13841279 TTTAAAATAAAGAATTTGACTGG + Intronic
1064611815 10:17111625-17111647 ATTAAAATACTAAATGTGGCTGG + Intronic
1064759437 10:18602994-18603016 TTTAAAATTCAGAATTAGGTCGG + Intronic
1065356223 10:24844646-24844668 TTTAAAAAAGAAAATGTGCAGGG + Intergenic
1065854403 10:29817999-29818021 TTTAAAAGACTGAATATGCACGG + Intergenic
1065986383 10:30957272-30957294 GTTAACATCCAGAATGTGTAAGG - Intronic
1066481725 10:35802564-35802586 TTAAAAATCCAAAATGTGGGTGG - Intergenic
1066609596 10:37227302-37227324 TTTTAAATACAGTATTTGGTGGG + Intronic
1067934471 10:50597458-50597480 TTTGATACACACAATGTGGATGG + Intronic
1068036245 10:51763547-51763569 TTTAAAATATATAATGTGGCTGG - Intronic
1068055387 10:52006302-52006324 AATAGAATACAGAATATGGATGG + Intronic
1069136350 10:64771203-64771225 TTTAAAATACATATTCTAGATGG + Intergenic
1069171636 10:65238093-65238115 TTAAAAGTACAAAATGTAGATGG - Intergenic
1070611480 10:77936141-77936163 TTTAAAACAGAGAATCTGGCTGG + Intergenic
1070652726 10:78249641-78249663 TTTAACATACAGAATAGGGTAGG - Intergenic
1071311709 10:84349092-84349114 TTTAAAAAGCAGTCTGTGGAAGG - Intronic
1071328364 10:84538515-84538537 TTTAAAATTGAGTATGTGGCTGG + Intergenic
1071339567 10:84631651-84631673 TTTAAAGTACTGCATATGGAAGG - Intergenic
1071350548 10:84738095-84738117 TTTAAAATACTGTATATGGGAGG + Intergenic
1071365430 10:84894906-84894928 TTTAAAATAAATAATTTGAATGG - Intergenic
1071915640 10:90292303-90292325 TTTAAAATACAAAATTGGGTAGG + Intergenic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1072428495 10:95350905-95350927 GATAAAATGCAGGATGTGGAGGG + Intronic
1072528129 10:96292814-96292836 TGTAAACTACAGAATTTGGGTGG - Intergenic
1072917885 10:99550881-99550903 TTCAGATCACAGAATGTGGAAGG + Intergenic
1073391638 10:103182347-103182369 TTTAAAATACAAAACCTGGGTGG + Intronic
1073497158 10:103903112-103903134 TTTAAAAAACAGGCTGTGGATGG - Intronic
1074042504 10:109805400-109805422 TTTAACATCCAGAATCTGTAAGG + Intergenic
1074140203 10:110665821-110665843 GTTAAAATACAGAAGTTGGCTGG + Intronic
1074811614 10:117110898-117110920 GTTAAAACACAGATTGTGGCTGG + Intronic
1075151585 10:119937462-119937484 TTAAAAATACAGAAATTAGATGG + Intronic
1076794222 10:132790893-132790915 TTTAAAGAACAGAAGCTGGAAGG - Intergenic
1077348930 11:2081413-2081435 TTTAAAATAAAGAATGTAATTGG - Intergenic
1077852046 11:6082563-6082585 TTTAAAATAAAGAATGTAATTGG + Intergenic
1078111351 11:8396365-8396387 TGTAAAATACTGTATGTGTATGG + Intronic
1078694643 11:13619384-13619406 CTTAGAATTCAGAATCTGGATGG - Intergenic
1078792560 11:14559201-14559223 TTTATAATTCAGAAATTGGAAGG + Intronic
1079119792 11:17673682-17673704 TTTGAAAGACAGATTGGGGAAGG - Intergenic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079555083 11:21750577-21750599 TTTAAAATAAAGGATGGGCATGG + Intergenic
1079812428 11:25011939-25011961 ATTAAAATACAAAATGGAGATGG + Intronic
1079892068 11:26068232-26068254 ATTAAATTAAATAATGTGGATGG - Intergenic
1079929961 11:26545984-26546006 TTTAAATTACACATTGTTGAAGG - Intronic
1080285308 11:30604881-30604903 TTCAAAATAAAAAATGGGGAGGG - Intergenic
1080293130 11:30693777-30693799 TTTAAAATATACAATGTGACTGG + Intergenic
1080308711 11:30865164-30865186 TTTAAAATGCAGATTTTTGAAGG + Intronic
1080593588 11:33747205-33747227 TTTAAAGTAAAGAAAATGGAAGG + Exonic
1081260931 11:40959656-40959678 TTAAAAATAGAGAAAATGGAAGG - Intronic
1081319987 11:41680073-41680095 CTTAAAATGCAGAATGGTGAAGG + Intergenic
1081336577 11:41874235-41874257 TGTAAACTGCACAATGTGGAGGG - Intergenic
1081543956 11:44056534-44056556 TTTAAAATACAGGATGAGGCCGG + Intronic
1081825752 11:46049710-46049732 TTTACAATATGGAACGTGGAGGG - Intronic
1083316566 11:61818210-61818232 TATAAAATGAAGAATTTGGATGG - Intronic
1084306173 11:68285153-68285175 TTTAAAATTCCTAATGAGGATGG + Intergenic
1084414049 11:69020504-69020526 TTGAAGTTACAGAATGTGCAAGG - Intergenic
1084538311 11:69771439-69771461 ATTAAAATTCAGAAAGTCGACGG + Exonic
1085063026 11:73465728-73465750 TTCAACATACAGATTTTGGAGGG + Intronic
1086048573 11:82562027-82562049 TTTAAAAAACCAAATGTGAATGG - Intergenic
1086242362 11:84710766-84710788 TATAAAATACATAATTTTGATGG - Intronic
1086597483 11:88590821-88590843 TTTAAAATAATGTATGTGAAAGG - Intronic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1086760203 11:90620399-90620421 AATATAATTCAGAATGTGGAAGG + Intergenic
1087120078 11:94564354-94564376 TTTAAAAAACCCTATGTGGAAGG + Intronic
1087217651 11:95511312-95511334 TGTAGAATTCAGAAGGTGGAAGG - Intergenic
1087219865 11:95535260-95535282 TGTAAAATACAGCCAGTGGAAGG + Intergenic
1087543610 11:99553571-99553593 TTTAAAATACATAATACTGAAGG - Intronic
1087551492 11:99656297-99656319 TTTGAAATTAAGAAGGTGGAGGG - Intronic
1087985541 11:104675239-104675261 TTTAATATACAGAATCTATAAGG + Intergenic
1088039887 11:105367264-105367286 CTTAAATTACAGTGTGTGGAAGG + Intergenic
1088237394 11:107740737-107740759 TATAGAATTCAGAATCTGGATGG - Intergenic
1088263700 11:107969957-107969979 TTTAAAATAGATTATGTTGATGG - Intergenic
1088271251 11:108036777-108036799 TTTAAAATAAGGAATAAGGATGG - Intronic
1088431158 11:109760435-109760457 TTTAATATTCAGAATCTAGAAGG - Intergenic
1088465502 11:110132519-110132541 TTTCCAATACAGTATCTGGAAGG + Intronic
1088509765 11:110562371-110562393 TTTAAAATACAGAGGGGGAATGG - Intergenic
1088548226 11:110983081-110983103 GTTGAAATATAGAAAGTGGAAGG + Intergenic
1088802835 11:113322255-113322277 TTTAAAGTACATAATTTAGAAGG + Intronic
1088963118 11:114691043-114691065 TGTAGAATTCAGAATGTGAATGG - Intronic
1089026596 11:115277025-115277047 GGCAAAATACAGAATGGGGAAGG + Intronic
1089162480 11:116450043-116450065 TTTAAAATATACAATTTGGTGGG - Intergenic
1089251556 11:117166369-117166391 TTAAAAACAAAGAATATGGAAGG - Intronic
1089899972 11:121971337-121971359 TTTATAATACAGAATTTGTCTGG - Intergenic
1089947492 11:122492544-122492566 TCTAAAATAAAGAATGATGATGG - Intergenic
1090905679 11:131072697-131072719 TTTTAAATTCAGAATGTCTAGGG + Intergenic
1091375222 12:20626-20648 GTATAAATACAGAAGGTGGAGGG + Intergenic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1092075364 12:5668426-5668448 TTTAATATCCAGAATCTGCAAGG - Intronic
1093577949 12:20756304-20756326 TTTAAAATTGAGAATGTCTAAGG - Intergenic
1093821772 12:23628070-23628092 ATAAAAATAAAGAATGTGTAAGG + Intronic
1093869873 12:24277379-24277401 TTGAAAATAGAAAATGTGTAAGG + Intergenic
1094317875 12:29151808-29151830 TTGAAAATAAAGAAAGTAGAAGG - Intronic
1094326123 12:29241099-29241121 TTTTAAATACACAATGAGGCCGG - Intronic
1094759157 12:33509816-33509838 TTTAAAATCCAAAATATAGAAGG + Intergenic
1095146268 12:38731417-38731439 TTTTAAAGACAGGATGTGGAGGG + Intronic
1095265515 12:40152451-40152473 GTTAACATACATATTGTGGAAGG + Intergenic
1095617803 12:44213422-44213444 TTTAAAAGTCAGAATTTGAAAGG + Intronic
1095864008 12:46951704-46951726 TTAAAAATAAAGAATGAGGCTGG + Intergenic
1097337768 12:58403602-58403624 TTTAACATAGAGAATGAGGTGGG - Intergenic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1097655900 12:62363185-62363207 TTTTAAGAACAGATTGTGGAGGG - Intronic
1097672698 12:62559005-62559027 TTTAATAAAAAGAATATGGAGGG + Intronic
1097846794 12:64374832-64374854 TTGAAAATAAAGACTGGGGATGG - Intronic
1098938649 12:76509165-76509187 TTTACTATACAGAATGTTGTAGG - Intronic
1099074036 12:78082701-78082723 TTAAAAGTAGAGAATTTGGAGGG - Intronic
1099532754 12:83805897-83805919 TTTAACATACAAATTTTGGAGGG - Intergenic
1099537335 12:83860549-83860571 TTTTAAATACAGCATGTGACAGG + Intergenic
1099627345 12:85091375-85091397 TCTAAAATACAGAATCTATAAGG - Intronic
1100116708 12:91314143-91314165 TTTAAAATATAGAAACTGGTTGG - Intergenic
1100240453 12:92706014-92706036 TTTAAATTACAGAATGAGACAGG - Intronic
1100946210 12:99786826-99786848 TATAAATTACTGAATGTGAAAGG + Intronic
1101829141 12:108243528-108243550 GTTAAAACACAGATTGTGGCTGG - Intronic
1102112526 12:110375176-110375198 TTCAGAGTACAGGATGTGGAAGG - Intronic
1102617231 12:114165304-114165326 ATTTAAATACAGTATGTGGAAGG + Intergenic
1103109331 12:118261445-118261467 TGTTAAATACAGAATCAGGAAGG + Intronic
1103780622 12:123396445-123396467 TTTAAATTCCAGTTTGTGGAGGG + Intronic
1104010958 12:124929651-124929673 TTCAACATACAGACTTTGGAGGG - Intergenic
1104134001 12:125920140-125920162 TTTAAACACCAGAATGTGGAAGG - Intergenic
1104498347 12:129261884-129261906 TTTAACATAATGAATTTGGAGGG + Intronic
1105505908 13:21009680-21009702 TTTAAAATACAGAAACCAGATGG + Intronic
1105914350 13:24898761-24898783 ATTAAAATACAGACAGTGGAAGG + Intronic
1106322841 13:28658676-28658698 TTTAAAAAACATAATATTGAAGG - Intergenic
1106664475 13:31837310-31837332 TTTAACATACAGCATCTGGGGGG + Intergenic
1107004180 13:35588823-35588845 TTGAATATACTGAATTTGGAAGG - Intronic
1107044490 13:35980550-35980572 TTAAAAAGACAGAAAGTAGAAGG - Intronic
1107525918 13:41231131-41231153 TATTAAAGACAGAAAGTGGATGG + Intronic
1107910878 13:45104896-45104918 TTTAAAATGCAGATTCTGGCCGG + Intergenic
1108111130 13:47073887-47073909 TATAAAATTCAGAATCTGGATGG + Intergenic
1108289464 13:48944158-48944180 TTTAAAATATTGAATGAAGATGG + Intergenic
1109111367 13:58323584-58323606 TTTTAAACACAGAAAGTGTAGGG + Intergenic
1109551720 13:63911214-63911236 TTTGAAATACAAAATTTGAAGGG - Intergenic
1109775914 13:67040699-67040721 ATTGAAATACAGAATGTGGTGGG + Intronic
1110297233 13:73882080-73882102 TTGAAAATACAAAGTGAGGAGGG + Intronic
1110342777 13:74413073-74413095 TATAAAATAAAGAATGGGGCTGG - Intergenic
1110662911 13:78079167-78079189 TTTAAAATACAAAATTTCAATGG - Intergenic
1111059724 13:83000220-83000242 TTCAAAATTCAGAGTGTGAAAGG - Intergenic
1111128261 13:83940614-83940636 TTTTGAATACCGAATGTGTATGG + Intergenic
1111157559 13:84348427-84348449 TTTAAAATATAGTATATGGGAGG + Intergenic
1111164294 13:84438052-84438074 TTTTAAATACAGTTTGTCGAGGG + Intergenic
1111319835 13:86612774-86612796 TTTAATATGCAGAATGTATAAGG - Intergenic
1111566037 13:90017346-90017368 TTTAAAATTCAGACTGAGGCTGG - Intergenic
1111597603 13:90431675-90431697 TTGAAATTACATAATGTTGATGG - Intergenic
1111758915 13:92436566-92436588 ATTACAATTCAGATTGTGGAAGG - Intronic
1112812204 13:103231888-103231910 TTTTAAAGACAAAATGTGGAGGG - Intergenic
1112814464 13:103255511-103255533 TTTAAAATACTGAAAATGGCTGG - Intergenic
1112853777 13:103739355-103739377 TTTAAAATACAGAAATTGTAAGG - Intergenic
1114282419 14:21205181-21205203 TTTAAAATACACGTTGTGGGTGG + Intergenic
1114595694 14:23909840-23909862 TTTAAAGCATAGAATGTGGCAGG - Intergenic
1114763880 14:25348599-25348621 TTTAAAATACAGAATGTAATTGG + Intergenic
1114896442 14:26996328-26996350 TTTAAAATAGAGGATATGTAAGG + Intergenic
1115301622 14:31892100-31892122 TCTAAACTTCAGAATGAGGAGGG + Intergenic
1115456131 14:33605270-33605292 TTTAAAATACTGATGGCGGAAGG - Intronic
1115564498 14:34613494-34613516 TTAAAAATACAGAATCTGGCTGG + Intronic
1115697693 14:35918391-35918413 TTTAAAATATAGAATTTAGTTGG - Intronic
1116358796 14:43966417-43966439 TTTAATATCCAGAATATGTAAGG - Intergenic
1116405303 14:44559117-44559139 TTTAAAATGTAAAATGTGGCCGG + Intergenic
1116472668 14:45304574-45304596 TATAGAATTCAGAATCTGGATGG - Intergenic
1116672444 14:47861025-47861047 TTAAAAATACAGTATGTGTTGGG + Intergenic
1116788828 14:49317954-49317976 TTTAAAATACACATTGGGGATGG + Intergenic
1117408579 14:55428873-55428895 TTTAAAATTCAGAACATGGTTGG - Exonic
1117546834 14:56799712-56799734 TGTAAACTACAGTATGTTGAAGG + Intergenic
1117819994 14:59638146-59638168 TTTAAAATACATTTTGTGGCTGG - Intronic
1117828835 14:59730345-59730367 TTTAAAATACAACATGAGGTAGG - Intronic
1117882493 14:60325957-60325979 GTTAAAATGCAGATTGTGGCCGG - Intergenic
1117932776 14:60862107-60862129 TTTAAAATACAGATCTTTGAAGG + Intronic
1118078001 14:62323493-62323515 TTTAAAATAAAGAGTGTGACTGG - Intergenic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1118513951 14:66507171-66507193 TTTAAAATTCAGAAGTTGAAAGG + Intergenic
1118662252 14:68027801-68027823 TATAAAATTCAGAATCTAGATGG - Intronic
1118684023 14:68272982-68273004 TTTAAAATATAGAAAGTGTTGGG - Intronic
1118872692 14:69756676-69756698 TTAAAAATTCAAGATGTGGAGGG - Intronic
1119574389 14:75705578-75705600 TTTAATCTATAAAATGTGGATGG + Intronic
1120097244 14:80402767-80402789 TACAAATTACAGAATGAGGAGGG + Intergenic
1120611549 14:86647133-86647155 TCTAAAATTCAGAATCTGGATGG + Intergenic
1120633469 14:86921407-86921429 TTTAAAATAAAAAAAGTGGAAGG - Intronic
1120719681 14:87877483-87877505 TTTAAAAAACAGAATCTTAAAGG - Intronic
1120950656 14:90038674-90038696 CTAAAAATACAGAATGTAGCTGG + Intronic
1121168647 14:91835494-91835516 TTTAAAATACAGCATATAAAAGG - Intronic
1122808369 14:104273897-104273919 TTTAAAATAAAGAATGTAATAGG - Intergenic
1123586800 15:21768102-21768124 TTTAATATCCAGAATCTGCAAGG + Intergenic
1123623439 15:22210667-22210689 TTTAATATCCAGAATCTGCAAGG + Intergenic
1123764486 15:23463401-23463423 TGAAAAACACAGAGTGTGGATGG - Intergenic
1124554529 15:30712147-30712169 TCTGAAATGCAGAATGTGGCTGG - Intronic
1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG + Intronic
1125153389 15:36559766-36559788 ATTAAAAACCAGAATATGGAAGG - Intergenic
1125254908 15:37752433-37752455 TTAATAAAACAGAATGTGGCCGG + Intergenic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126247247 15:46523040-46523062 TATAAAATACAGAATGTTAGAGG + Intergenic
1126256563 15:46634058-46634080 TTTGTAAAACAGAATGTGAACGG - Intergenic
1126287339 15:47028058-47028080 TATAGAATTCAGAATCTGGATGG + Intergenic
1126513955 15:49513480-49513502 TTTAATATCCAGAATGTACAAGG - Intronic
1126704423 15:51394449-51394471 TTTAAAATACAAAAATTAGATGG + Intronic
1127305039 15:57697200-57697222 TTAAAAATTCAGAATGTGGCTGG + Intronic
1128474248 15:67983617-67983639 AATAAAATAAAGAATGTGGCTGG + Intergenic
1128790246 15:70427915-70427937 TTTAAAAGACAGACTCAGGAAGG + Intergenic
1129148476 15:73671146-73671168 TTTAGAAGACAGAAAGTAGATGG - Intergenic
1129616445 15:77102093-77102115 TTTACAGTAGAAAATGTGGAAGG - Exonic
1130129048 15:81121394-81121416 TTTAAAATACAGATTTAGGAAGG - Intronic
1130246850 15:82259542-82259564 TTTGTAATATAGCATGTGGAGGG + Intronic
1130433447 15:83873006-83873028 TTTAAAAGGAAGAATGTGGCTGG + Intronic
1130851358 15:87797337-87797359 TTTAAAATAATGAATGAAGATGG - Intergenic
1132451354 15:101970348-101970370 ATATAAATACAGAAGGTGGAGGG - Intergenic
1133080315 16:3313684-3313706 TATAGAAAACAGACTGTGGAAGG - Intronic
1134423833 16:14119420-14119442 TTTAAAATACATAAGGAGGCAGG + Intronic
1135283020 16:21169603-21169625 TTAGAAATACAGAATCTGGCTGG - Intronic
1135318348 16:21471214-21471236 TTTAAAATACTGACTGGGCACGG + Intergenic
1135371241 16:21903009-21903031 TTTAAAATACTGACTGGGCACGG + Intergenic
1135440546 16:22467706-22467728 TTTAAAATACTGACTGGGCACGG - Intergenic
1136048065 16:27631191-27631213 TTTAGAATACAGAGTGTGGGTGG + Intronic
1136328550 16:29552645-29552667 TTTAAAATACTGACTGGGCACGG + Intergenic
1136443237 16:30292659-30292681 TTTAAAATACTGACTGGGCACGG + Intergenic
1136526231 16:30833069-30833091 TAAAAAATACAGAAAGTGGCCGG + Intergenic
1137223976 16:46483814-46483836 CTTAGAATCCAGAATCTGGATGG + Intergenic
1137330077 16:47485469-47485491 ATTAAATCAGAGAATGTGGATGG + Intronic
1137399624 16:48142650-48142672 TATAATATAAAGAATGGGGAAGG - Intronic
1138238210 16:55403577-55403599 TTTGAATTACAGACTGTGTAAGG - Intronic
1138634750 16:58328898-58328920 TTTAAAATCCAGACTAAGGAAGG + Intronic
1138827883 16:60342614-60342636 TTTCAAATACAGAATATGAGTGG - Intergenic
1139323628 16:66134956-66134978 TTTAGAATATAGGATGTGGGAGG - Intergenic
1139454609 16:67063183-67063205 TTTTAAATGCACAGTGTGGAAGG + Intronic
1139598532 16:67971911-67971933 CTAAAAATACAAAATTTGGATGG + Intergenic
1139889962 16:70245079-70245101 TTTAAAATACTGACTGAGCACGG + Intergenic
1140087017 16:71806149-71806171 TTTAAAGTACAGAATTTGCCAGG - Intronic
1140160640 16:72488797-72488819 TTTAAAATAAAAAATGTAAAGGG - Intergenic
1140331782 16:74064689-74064711 TTAAAAAAACAGAAGGTGAAGGG + Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1143150337 17:4803881-4803903 CTAAAAATACAAAATGTGGCTGG - Intergenic
1144091141 17:11857570-11857592 TTCAGAATACAGAAAGTGGGTGG + Intronic
1144213218 17:13032641-13032663 GTTAAAATGCAGATTGTGGCTGG + Intergenic
1144236897 17:13270566-13270588 TATAACATACAAAATGTGGCTGG + Intergenic
1145115003 17:20201162-20201184 TTTAAAAAAAAGAAAGTGGCTGG + Intronic
1145775218 17:27522981-27523003 TTAGAAATACAGCATGGGGAGGG + Intronic
1146066582 17:29640375-29640397 TTTAAAAAACATACTTTGGAGGG - Intronic
1146168061 17:30607248-30607270 TTTCAAATAAGGAATATGGAAGG - Intergenic
1146188980 17:30748392-30748414 TTAAAAATACAGAAAGTAGCTGG - Intergenic
1146386574 17:32382011-32382033 TATTAAATACAGAATGTCTACGG + Intergenic
1146474002 17:33147197-33147219 TTTAGAACACATAAAGTGGATGG + Intronic
1146747434 17:35344979-35345001 TTTAAAACCCAGAATGGGCAGGG + Intergenic
1147957497 17:44144435-44144457 CTTAAAATACAAAATTTGGTCGG - Intronic
1148270416 17:46258370-46258392 TTAAAAATACAGAAAGTAGCTGG - Intergenic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150268162 17:63844125-63844147 TTAAAAATGCAGATTGTGGCAGG + Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1150863689 17:68827314-68827336 TTTAAAATAAAGAATGTAACTGG - Intergenic
1151019542 17:70599189-70599211 TTTAAAATAAAGAATGTGATTGG + Intergenic
1151068989 17:71186657-71186679 TTAAAAAAACAGAGTGGGGAAGG + Intergenic
1151123828 17:71823306-71823328 TTGGAAATACCCAATGTGGATGG + Intergenic
1151817943 17:76480681-76480703 TTTTAAATTCAGAATGAGGCTGG - Intronic
1152060028 17:78065543-78065565 TTTAAATTACTTAATGTGGCAGG - Intronic
1152109701 17:78351060-78351082 TGTAATGTACAGAATGTTGAAGG - Intergenic
1153272002 18:3331743-3331765 TTAAAAAAACAGAATTTGTAAGG - Intergenic
1153594560 18:6711603-6711625 TTCAAAAGACAGAATGTAAAAGG + Intergenic
1154222570 18:12469490-12469512 TTAAAAAATCAGAATGTGGCTGG - Intronic
1155788850 18:29937454-29937476 ATTAATATACAGAATATGCAAGG - Intergenic
1155947779 18:31876036-31876058 TTCAAAATAGAGAATTTGAATGG + Intronic
1156169940 18:34470466-34470488 TTTAATATCCAGAATCTGTAAGG - Intergenic
1157045478 18:44098352-44098374 CATAAAATTCAGAATCTGGATGG - Intergenic
1157053502 18:44198028-44198050 TATAAAACACGGAATGTGGATGG + Intergenic
1157300531 18:46475869-46475891 TTTAAATTATAGAATGGAGATGG + Intergenic
1157995872 18:52555009-52555031 TTCAAAAGACTGAAGGTGGAAGG + Intronic
1159255588 18:65940891-65940913 ATGAAAATAAAGAATGTTGAGGG + Intergenic
1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG + Exonic
1159439947 18:68465535-68465557 TTTAAAATACTGAATGGAGGAGG - Intergenic
1159510114 18:69387008-69387030 TCTAGAATAAAGAAAGTGGATGG + Intergenic
1160633910 19:62199-62221 GTATAAATACAGAAGGTGGAGGG + Intergenic
1161309106 19:3584301-3584323 TTTAAAAAACTGAATGCGGCCGG + Intergenic
1161557551 19:4952717-4952739 TGTAACATAAAGAATGTGAAAGG + Intronic
1161666698 19:5581463-5581485 TTTAAAATACAGGTTTTGGCCGG - Intergenic
1162067323 19:8133928-8133950 TTTAAAAAAAAAAATGTGGCTGG + Intronic
1162368406 19:10263702-10263724 TTTAAAATATATTTTGTGGACGG + Intergenic
1162748762 19:12815102-12815124 TGTAAAATACATGATGTGGCTGG + Intronic
1165675037 19:37715200-37715222 TTTAAGAAACAGAAAGTGGCTGG - Intronic
1166211118 19:41307052-41307074 TTTAAAAAGCAAAATGGGGAGGG + Exonic
1168209843 19:54882319-54882341 TATAGAATTCAGAATCTGGATGG - Intronic
1168652736 19:58102521-58102543 TTTAAAGTTCATAATGTGGGGGG - Intronic
924969825 2:115666-115688 TTTACAATGCAGAAGGTAGACGG + Intergenic
925015282 2:519513-519535 TTTTAAACACAGAATGGAGAAGG - Intergenic
925557978 2:5153188-5153210 TTTAAAATCCAAAAAGTGAATGG - Intergenic
926080681 2:9983858-9983880 TTTAAAAAAAAAAATGTGGCCGG + Intronic
926389822 2:12377847-12377869 AATAAAATACAGGATATGGAAGG - Intergenic
926446936 2:12954403-12954425 TTTAACATAAAGCATGTTGATGG - Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
926576810 2:14591589-14591611 TTTAAAATGCTGAGTGTGGAAGG - Intergenic
927051673 2:19336411-19336433 TTTAAAACACTGAATATGGCTGG - Intergenic
927162696 2:20283266-20283288 TTTAAAATACAGAATTTTCTGGG - Intronic
927812933 2:26190245-26190267 TTTAGAATGCAGAATGTGATGGG + Intergenic
928312086 2:30219613-30219635 TTTAAAAAATAGAATATAGAGGG + Intergenic
928793482 2:34987638-34987660 TTTAATGAACAGAATGTGGCAGG - Intergenic
928796537 2:35028903-35028925 TTTCAAAAACAGAATTTGGCTGG - Intergenic
929203063 2:39258226-39258248 TTTAAAATAAAGGATATGGCTGG - Intronic
929636676 2:43529507-43529529 TTTAAAATAAATAATCTGGCCGG - Intronic
929698893 2:44144556-44144578 TTCAAAATAAAAAATTTGGAAGG - Intergenic
929892733 2:45932011-45932033 TTAAAAATTCAGTATGTGGCCGG - Intronic
930105306 2:47634554-47634576 TTTAAAATGCAGATTTTGGCTGG + Intergenic
930178713 2:48328381-48328403 CTTAAAGTACAGTATATGGAAGG - Intronic
930630358 2:53746779-53746801 TTGTAAAAACATAATGTGGAAGG - Intronic
930713044 2:54567212-54567234 CTTAAAGTACAGAGTGAGGATGG + Intronic
930874491 2:56199255-56199277 ATACAAATACAGAATGTGTAGGG + Intronic
931404380 2:61962272-61962294 TGTATAATAAAGAATGTGGTTGG + Intronic
933293201 2:80460639-80460661 TGTAAAATACAAGATGTGGTAGG - Intronic
933806864 2:86004808-86004830 TTAAAAGTACAGGATGTGGGAGG + Intergenic
934017599 2:87905327-87905349 TTTGAAATAGAGAATATGGCAGG + Intergenic
934029145 2:88025874-88025896 TTTAGAATACAAAATGGGAAGGG + Intergenic
936567569 2:113592830-113592852 GTATAAATACAGAAGGTGGAGGG - Intergenic
936779373 2:116013727-116013749 TTTAAAATATAACATGTGGCTGG - Intergenic
937659888 2:124418837-124418859 TTTAAAATACAGTATGGGCCGGG + Intronic
938023864 2:127927972-127927994 TTTAAAAGACAGAATGGGGTGGG + Intergenic
938418239 2:131122209-131122231 TTTAAAACACAGTATGAGGCCGG - Intronic
939125248 2:138170417-138170439 TTTAATATCCAGAATGTATAAGG + Intergenic
939151446 2:138477801-138477823 TTAAAAATACAGAATTTAGCCGG + Intergenic
939380608 2:141430831-141430853 TTTAAAATAGAGAAATTGGCTGG + Intronic
940581528 2:155585696-155585718 TGTAAAATACAGAATTTAGATGG + Intergenic
940750654 2:157623726-157623748 TTTAAAATAAAGAATGTAATTGG + Intronic
940937351 2:159511799-159511821 GTTAAAATAAAGAATGTTGTAGG + Intronic
941133949 2:161690062-161690084 TCTAATATACAGAATCTAGAAGG + Intronic
941168050 2:162104536-162104558 TTTAAAATACTTAATGTGTGTGG + Intergenic
941202774 2:162533476-162533498 TTTAAAATACAGAAAGAAAATGG + Intronic
941224127 2:162824242-162824264 TTTAAAATAAAGAATGTTGGTGG + Intronic
941496802 2:166214808-166214830 TTTAAAAGAAAGATTGTGGCCGG - Intronic
941653902 2:168122954-168122976 TTTACAATAAAGAAACTGGAAGG + Intronic
942873400 2:180763607-180763629 ATTAATATACAGAATGTTGTGGG - Intergenic
942892768 2:181012420-181012442 TTTAAATTAAAGAATGTCAAGGG + Intronic
943121036 2:183735974-183735996 TGGAAAGTACAGAATGGGGAAGG - Intergenic
943317225 2:186405132-186405154 TTTAAAATTAAGATTGTGAAGGG - Intergenic
943757952 2:191577092-191577114 TTTAAAATACAGAAGGGAGATGG - Intergenic
943866617 2:192932010-192932032 TTTAAATTACAGCCTGTGGAAGG + Intergenic
944051226 2:195472283-195472305 TTTCAAATAAAGAAAGGGGAAGG - Intergenic
945548085 2:211182976-211182998 TGTAAAAGCCAGAAAGTGGACGG - Intergenic
945758452 2:213880355-213880377 TTTAATATACAGAATCTACAAGG - Intronic
946118624 2:217489101-217489123 TTTAAACTACAGAATGTTTCAGG - Intronic
946613143 2:221480694-221480716 TTTAAAATATCTAATGTGAACGG - Intronic
946959060 2:224964085-224964107 AATAAAATACAGGATGCGGAGGG + Intronic
947444216 2:230150966-230150988 TTAAAAATAGAGAACCTGGATGG + Intergenic
947671514 2:231939493-231939515 TATTAAATATAAAATGTGGAAGG - Intergenic
948016298 2:234693397-234693419 ATTAAAATCCTGAATGTGGCCGG - Intergenic
948195022 2:236089015-236089037 TTCAAAGTACAGAAGGTAGAAGG + Intronic
948575221 2:238945579-238945601 TTAAAAATAAAAAAGGTGGAAGG - Intergenic
1169162583 20:3394507-3394529 TTTATAATACTGACTGGGGAAGG - Intronic
1170079964 20:12463925-12463947 TTTAAAATACAAAAAGTTCAAGG - Intergenic
1170316638 20:15048799-15048821 TCTATAATTGAGAATGTGGATGG - Intronic
1171027295 20:21642424-21642446 TTTAAAATACAGGTGGGGGATGG - Intergenic
1171492319 20:25529881-25529903 GGTAAAATTCAGAATGTGAAAGG + Intronic
1171972812 20:31574846-31574868 TTAAAAATACAAAATGAGGCCGG - Intronic
1172380435 20:34485932-34485954 ATTAGAAAACAGAATGTGGGAGG - Intronic
1172381610 20:34497738-34497760 CTAAAAATACAGAAAGTGGCTGG - Intronic
1173155871 20:40608201-40608223 ATTAAAATAAACAATGTGGAGGG - Intergenic
1174031315 20:47630248-47630270 TTTAAAATTCAGAATTTTAATGG - Intronic
1174288839 20:49492460-49492482 TTTAAAATAAAGAATGCAGTTGG + Intergenic
1175417573 20:58811870-58811892 TGTAAAATAAAGGAGGTGGATGG - Intergenic
1176968646 21:15240079-15240101 TTTAAAATATTGCATGTGGCTGG - Intergenic
1177214773 21:18114270-18114292 TTTAAAATAAAGAATGTAATTGG + Intronic
1177462120 21:21426167-21426189 TTCAACATATAAAATGTGGAGGG + Intronic
1177538297 21:22458453-22458475 TGTGGAATAAAGAATGTGGAAGG + Intergenic
1177561866 21:22766222-22766244 TTCAACATACGGAATTTGGAGGG + Intergenic
1177650385 21:23953144-23953166 GTTAAAACACTGAATGTTGAAGG + Intergenic
1177716385 21:24844612-24844634 TATAAATTAGAGAATGTGGCTGG + Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1177960318 21:27657671-27657693 TTTGAAATACAGTATTTAGAAGG + Intergenic
1178662158 21:34516428-34516450 TTTAAACTGCAGAATTTAGAAGG + Intronic
1178977568 21:37232685-37232707 TTTAAAATTCTGAATCTGAAAGG - Intronic
1179198014 21:39183670-39183692 TTTAAATTACAGATTGGGGGAGG + Exonic
1179394831 21:41029558-41029580 TTTAAAATACAGCAATTGCAAGG + Intergenic
1179828815 21:43983308-43983330 TTTAAAAAACAGAGGGTTGACGG - Exonic
1180116229 21:45707217-45707239 TTTAAAATGCAGATTCTGGCTGG + Intronic
1180256689 21:46634890-46634912 TTTAAAAAAAAAAATGTGGAAGG - Intergenic
1180924220 22:19542306-19542328 TTAAAAATACAGAAATTGGCTGG - Intergenic
1181516006 22:23413714-23413736 TTTAAATTAAGGAATGTGCATGG + Intergenic
1182971728 22:34585623-34585645 TTTTAAATACAAAATGTTCATGG + Intergenic
1183050198 22:35254716-35254738 TTGAAAACACAGCATGTGGCAGG - Intergenic
1183130535 22:35830832-35830854 TATAAAATACAGCATATGGAGGG + Intronic
1183809475 22:40242589-40242611 TTTAAAATACAAAATTAGGTGGG - Intronic
1183974936 22:41506547-41506569 TATAAAAAACAGAATGAGGCCGG - Intronic
1184020728 22:41819604-41819626 TTAAAAATATATAATGTGGTAGG + Intronic
1184440361 22:44508647-44508669 TTTAAAAGAGAAAATGTGGCTGG + Intergenic
1184526598 22:45027543-45027565 TTCAACATACAGATTTTGGAGGG - Intergenic
1184963280 22:47947338-47947360 TTTAGTATTCAGCATGTGGAAGG + Intergenic
1185123907 22:48993292-48993314 TTTAAAAAATACAAAGTGGATGG - Intergenic
949134749 3:550700-550722 GATGAAATACAGAATGTTGATGG + Intergenic
949311931 3:2709615-2709637 TTTAAATTCCACAATGTGGCTGG + Intronic
950358361 3:12430770-12430792 TTCAAAATACAGCCTGTGGTGGG - Intronic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951700812 3:25494814-25494836 TTTTAAACATAGAATGTGTATGG + Intronic
951744000 3:25956572-25956594 TTTAAAATAACGACTCTGGAAGG - Intergenic
952845586 3:37685412-37685434 TTTAGAATATAGAAAGTGGATGG - Intronic
955202898 3:56867364-56867386 TAAAAAATACATAATGTGGCAGG + Intronic
955327906 3:58023791-58023813 TTTAAGAGACAGAAAGTGGCTGG - Intronic
955509832 3:59668370-59668392 TTTAAAAGACAGAATGAGTCAGG - Intergenic
955554750 3:60124959-60124981 ACTAAAATAGAGAATTTGGAGGG - Intronic
955646691 3:61146576-61146598 TTTAAACTACAGAATCTGCTTGG + Intronic
955944359 3:64178262-64178284 TTTAAGATACAGAATATATACGG - Intronic
955947765 3:64211697-64211719 TTTAAAACAAAGAAAGTGGTTGG + Intronic
955991665 3:64634254-64634276 TTTAAAATGTAGAAGGTGAAAGG + Intronic
956469986 3:69556213-69556235 TTTTAAATACTGTATATGGAAGG - Intergenic
956520046 3:70094086-70094108 TATAAAATTCAGATTGTGCACGG + Intergenic
956585384 3:70859086-70859108 TTTGAGTTACAGAATGTGGTAGG + Intergenic
956585753 3:70862773-70862795 TATAAAATACAGAAGATGGAAGG - Intergenic
956679638 3:71766385-71766407 GATAACATACAGAATGTGGCTGG + Intergenic
957307597 3:78478219-78478241 TTTAAAAATCAAAATATGGAAGG - Intergenic
957371236 3:79297080-79297102 TTTCAAATACAAAATGTAGTTGG + Intronic
957571358 3:81950780-81950802 TTTACAATACATAATGTTCAGGG + Intergenic
957638078 3:82813240-82813262 TATAAAATCCAGAATGTATAAGG - Intergenic
957895776 3:86420001-86420023 TTTTAAATCCAGAAGATGGAGGG - Intergenic
957915043 3:86677602-86677624 TTTAATATCCAGAATCTGTAAGG - Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958507111 3:94993758-94993780 TTTAAAATACAAAGTGTGGCAGG - Intergenic
959381858 3:105650750-105650772 TTTAAAATATATAATCTGGCTGG - Intergenic
959455708 3:106558310-106558332 TTTATGATACAGAACGTGCAGGG - Intergenic
959587753 3:108040922-108040944 TTAAAAATACTGTTTGTGGAGGG - Intergenic
959630578 3:108502850-108502872 CTTGAAATACAGAAAGTGAAGGG - Intronic
960104614 3:113781200-113781222 TTTGAAATATAGAAAGTGGCAGG - Intronic
960313131 3:116141527-116141549 GTTAAATTACAGAATGTGGCAGG + Intronic
961041377 3:123680842-123680864 TTTAAAACACAGCATGTGCTGGG + Intronic
962057628 3:131888751-131888773 TTCAAAATGCAGAGAGTGGAGGG + Intronic
962479003 3:135782312-135782334 TTTAAAATTCAGATTGTGACTGG + Intergenic
962534919 3:136319282-136319304 TTTAATATACAGAATATACAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963300711 3:143594069-143594091 TTTAAAATCCAGAATTTTAAGGG - Intronic
963503617 3:146159324-146159346 TTTAAAATCCAGAGTGAGAAGGG + Intronic
963564771 3:146915506-146915528 TTAAAAATACAAATTGTAGAAGG - Intergenic
963739048 3:149056812-149056834 TTAAAAATACAGAATGGGCCGGG + Intronic
964388285 3:156172592-156172614 TTTAAAAAAGGGAATGAGGATGG + Intronic
964696429 3:159512976-159512998 CTTAAAATACAGCAGGTGAATGG + Intronic
964703241 3:159591945-159591967 TTAAAACTAAAAAATGTGGAGGG + Intronic
965952974 3:174333544-174333566 TTTAAAATAGAGAATGTGAAAGG + Intergenic
965968349 3:174523891-174523913 TTTAAAATTCAGGTTGTGAATGG + Intronic
966666943 3:182481750-182481772 TTAAAAATAAAGAATGTGGCCGG - Intergenic
966783553 3:183605724-183605746 TTTGAAATACAAAATTTGGCCGG + Intergenic
966901262 3:184487631-184487653 TCTAATATACAGAATCTGGCCGG - Intronic
967469645 3:189846979-189847001 TCTTTAATAAAGAATGTGGAAGG - Intronic
967490391 3:190083979-190084001 TTTAAAAAACATAATGAGAATGG - Intronic
967731248 3:192908957-192908979 ATTAAAATACAAAATGCGGCCGG + Intronic
968028195 3:195460916-195460938 TTCAAAATACAAGATGTGGCCGG + Intergenic
968588128 4:1443195-1443217 TTAAAAATACAAAAAGTGGCCGG - Intergenic
969833234 4:9815871-9815893 TTTAAAATAAAAAATGAGGCCGG + Intronic
970822035 4:20228482-20228504 TTTAAAAAACCAAATATGGAGGG - Intergenic
971001626 4:22329688-22329710 TTTAAAATACAGATTGGGACTGG - Intergenic
971005309 4:22367748-22367770 TTTAATATACAAATTGTGGGTGG - Intronic
971550587 4:27950966-27950988 TCTAATATCCAGAATGTGTAAGG + Intergenic
971659573 4:29394664-29394686 TTTGAAATAGAGAATTTGGCTGG - Intergenic
972961272 4:44455123-44455145 TTATAAATGTAGAATGTGGATGG + Intergenic
973034544 4:45390061-45390083 CATAAAATTCAGAATCTGGATGG - Intergenic
973545831 4:51981021-51981043 TTTAAAAATCTGAAAGTGGAAGG + Intergenic
973788187 4:54354358-54354380 ATCAAAATACAGAAAGTAGAAGG + Intergenic
973909196 4:55562423-55562445 TTGGAATTATAGAATGTGGAGGG - Exonic
974364537 4:60929202-60929224 TTTAAAACACAGAAATTGGCTGG + Intergenic
974583711 4:63841025-63841047 TTTAAAAAACAAAATTTAGATGG + Intergenic
975005325 4:69276104-69276126 GAGAAAATACTGAATGTGGATGG + Intergenic
975015002 4:69404441-69404463 GAGAAAATACTGAATGTGGATGG + Intronic
975394462 4:73858788-73858810 TTTAAAAAATGGAATGTGGTAGG - Intergenic
975514253 4:75227516-75227538 GGTAAAATACATATTGTGGAAGG + Intergenic
976176599 4:82360305-82360327 TTTAAAATGCAGAAAGTGATGGG + Intronic
976180773 4:82396729-82396751 TTAAAAATAAAGAATGTGGCCGG + Intergenic
976586804 4:86807510-86807532 TTTAAAATGCATGATATGGATGG + Intronic
976828120 4:89283238-89283260 TTTAACATACACAATGTGCCAGG + Intronic
977044977 4:92058216-92058238 TTTAAAATAAAGAATGTAATTGG + Intergenic
977216283 4:94287695-94287717 TTTAAAATAAAGATTGTGTTTGG + Intronic
977334651 4:95681665-95681687 TTTAATATACACAATATAGAAGG - Intergenic
978257353 4:106708757-106708779 TTCAAAATACAGAAAAGGGAAGG - Intergenic
978770444 4:112451162-112451184 TTAAAAATCCAGACTGTGAAAGG + Intergenic
978800193 4:112748860-112748882 TTTAAAATAAAGTCAGTGGACGG + Intergenic
978835482 4:113144585-113144607 TTTAATTTATAGCATGTGGATGG + Intronic
978911763 4:114071582-114071604 TATAGAATTCAGGATGTGGATGG + Intergenic
979204443 4:118020658-118020680 TTTAAAATGCAGAATAAGAAAGG - Intergenic
980088261 4:128415168-128415190 TATAGAATTCAGAATATGGATGG - Intergenic
980162785 4:129185841-129185863 TTTAATATACAAAATATGTAAGG - Intergenic
980559294 4:134451672-134451694 TTTAAAATACAGGCTGGGCATGG - Intergenic
980708563 4:136533160-136533182 TTTAAAGTGCATAATGTTGAAGG + Intergenic
980907386 4:138961693-138961715 TGTAAGATTCAGAATGGGGAGGG - Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
981466344 4:145076627-145076649 TTCAGAATTCAGAATCTGGATGG + Intronic
982692237 4:158561922-158561944 TTTAAAATACAGGTTGAGGCCGG - Intronic
982834396 4:160105706-160105728 TTTATACTACAGCATTTGGATGG - Intergenic
983483206 4:168301201-168301223 TTAAAAATAAAGAAAGGGGAGGG + Intronic
983557767 4:169073757-169073779 TATAAAAAGCAGAATGTGGCCGG + Intergenic
983877240 4:172892077-172892099 AATAAAATCCAGAATTTGGATGG - Intronic
984210652 4:176843424-176843446 TTTCAAATATTAAATGTGGAGGG - Intergenic
984901265 4:184588727-184588749 ACTAATACACAGAATGTGGATGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986114836 5:4762831-4762853 TAAAAAATACAGACTGTGCAAGG - Intergenic
986186444 5:5445708-5445730 TTTTAAATAAAAAATGTGGCTGG - Intronic
986390104 5:7277446-7277468 TTAAAAATACAGATTTTGGCCGG - Intergenic
986437696 5:7750592-7750614 TTTAAAATACAAAATCTGAGTGG - Intronic
986723559 5:10577655-10577677 TTTAAAATACAAAAGCTGCAAGG - Intronic
988162035 5:27531151-27531173 TATAGAATGCAGAATCTGGATGG - Intergenic
988489724 5:31696150-31696172 TTAATCATACAGCATGTGGATGG + Intronic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988572164 5:32378747-32378769 TTTAAAATAATGTATGTGGTTGG - Intronic
989049006 5:37300295-37300317 TTTAAAATAGAGAATGTAATTGG - Intronic
989304468 5:39937006-39937028 TTTAGAAAACAGAAGATGGAGGG + Intergenic
989312535 5:40036987-40037009 TTTATCATCCAGAATGTGAAGGG + Intergenic
989762285 5:45030838-45030860 TTTAGATGACAGAATGAGGATGG + Intergenic
990256939 5:53980530-53980552 GTTAAATTACAGGAGGTGGATGG + Intronic
990344473 5:54857875-54857897 TTGAACGTAAAGAATGTGGAAGG + Intergenic
990817800 5:59805087-59805109 ATTAAGAAACAGAATGTGGCAGG - Intronic
991059767 5:62361454-62361476 TTTAAAATATAGACTATGGGTGG + Exonic
991344847 5:65653404-65653426 GTAAAAATTCAGATTGTGGATGG - Intronic
991471938 5:66978222-66978244 TGTAAAATTCAGAAAGTGAAGGG - Intronic
992466603 5:77012274-77012296 TTGAAAATACAGCTTGTGGTGGG - Intergenic
992511445 5:77439839-77439861 TTTAAAATAGATAATTTGTAGGG + Intronic
993039284 5:82794156-82794178 TTTAAAATTTAGTATTTGGATGG - Intergenic
993429566 5:87814794-87814816 TGTAGAATTCAGAATCTGGATGG + Intergenic
993606848 5:90001305-90001327 TTAAAAATACAAGATATGGATGG + Intergenic
994024442 5:95066116-95066138 ATTAATATCCAGAATGTAGAAGG + Intronic
994318261 5:98359906-98359928 TTTAGAATTCAGAATTTGGATGG - Intergenic
994614373 5:102085281-102085303 TTTAAATTCCAAAATGGGGAAGG - Intergenic
994934029 5:106228854-106228876 TTTAACATACAGAATGACTATGG - Intergenic
994981608 5:106881454-106881476 TATAAAAGACAGAATTAGGAAGG - Intergenic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995279072 5:110312312-110312334 TTTAAAGTACAGAAGATCGATGG + Intronic
995626858 5:114088915-114088937 TTTAAAATAAAAAATGTGGCTGG - Intergenic
995827758 5:116319913-116319935 TGTAAAATACAGTATCTGGGAGG - Intronic
996178019 5:120383724-120383746 TTACAAATAAAGAATTTGGAAGG - Intergenic
996311804 5:122114621-122114643 TTTAAAAAAAGGAATGTAGAAGG - Intergenic
997021608 5:130008641-130008663 TATAGAATTCAGAATCTGGATGG + Intronic
997894928 5:137708008-137708030 TTTAAAATAGAGATTGATGAAGG + Intronic
998420578 5:141981565-141981587 TGTAAAATGCAGAATGGGGCTGG + Intronic
999139978 5:149354143-149354165 TTTAAAAACCAGAAAATGGAAGG - Exonic
999793495 5:154965767-154965789 TTTGATATACAGAATGGGGGAGG + Intronic
1000952839 5:167505570-167505592 TTTAAAATACTCAATTTGTATGG + Intronic
1000955273 5:167535636-167535658 TTTACATGGCAGAATGTGGAAGG - Intronic
1001028697 5:168245934-168245956 TTCAAAATGCAGGATGTGGCTGG + Intronic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1003412573 6:5878504-5878526 TTTGCAATACAGAATGGGTAGGG - Intergenic
1003908935 6:10726199-10726221 TTTTACATACAGAACATGGAAGG + Intronic
1003913967 6:10768278-10768300 TTAAAAATATAAAATGTGGCCGG + Intronic
1005359381 6:25016367-25016389 TTTAAAGTAGAGAATAAGGATGG + Intronic
1005408878 6:25521471-25521493 TTATCAATAAAGAATGTGGATGG + Intronic
1006622417 6:35375054-35375076 TTTCATAAACAGAATGTGGCTGG + Intronic
1006808021 6:36801258-36801280 GGTAAAATACAGATTGTGGAGGG + Intronic
1007296743 6:40828856-40828878 TTTAAAAATAAGCATGTGGATGG - Intergenic
1007466748 6:42057621-42057643 TTCAAAACTCAGAATGTGGCCGG + Intronic
1008020964 6:46576520-46576542 TATAGAATTCAGAATCTGGATGG + Intronic
1008084807 6:47233309-47233331 TTTAGAATTCAGAAGGTGAATGG + Intronic
1008120680 6:47613323-47613345 TTTAAGATACACATTTTGGAAGG - Intronic
1008222083 6:48867351-48867373 ATCAAAATAAAGAGTGTGGAAGG - Intergenic
1008449214 6:51630759-51630781 TATAAAATACAGAAGGTATAAGG + Intronic
1008654143 6:53594105-53594127 ATTAAAATGCAGGATGTGCAGGG + Intronic
1008939070 6:57025955-57025977 TTAAAAATACAAATTGTTGAGGG - Intronic
1009517098 6:64634295-64634317 TTTAAACAACAGAATTTTGAGGG + Intronic
1010472736 6:76249099-76249121 TGTATAAAACAGAATGTAGACGG + Intergenic
1010518740 6:76807125-76807147 TTTAAAATACAATATTTGGCTGG + Intergenic
1010550749 6:77220189-77220211 TCTAACATCCAGAATGTGTAAGG + Intergenic
1010709960 6:79162323-79162345 TTTAAAATACACAATCTAGTAGG - Intergenic
1010859734 6:80894599-80894621 TTTAATATTCAAAATGTGTAAGG - Intergenic
1011028550 6:82896042-82896064 TTAAAAATACATAATGTGCTCGG - Intronic
1011043416 6:83056192-83056214 TACAGAATACAGAATATGGATGG + Intronic
1011184264 6:84657057-84657079 TTCAACATACAGATTTTGGAAGG - Intergenic
1011305410 6:85920487-85920509 TTTAAATTACAGAATATCAAAGG + Intergenic
1011731938 6:90273760-90273782 TTTAAATTACTGAGTGTGGAGGG + Intronic
1011988993 6:93488630-93488652 TTTAAAATAAATAATTTGGGAGG - Intergenic
1012338916 6:98094175-98094197 TTAAAAATAAATAATGTGGCCGG + Intergenic
1012493006 6:99803178-99803200 TTTAAACTTCAGGTTGTGGAAGG - Intergenic
1012570203 6:100715782-100715804 TTTAAAATACAGTATCTTTAAGG + Intronic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1013231004 6:108162442-108162464 ATTAAAATACCGAAGGTGAAAGG - Intronic
1013338037 6:109185259-109185281 TTGAGAAAACACAATGTGGATGG + Intergenic
1013359121 6:109377459-109377481 ATTAAAATACAGAAAATGGATGG + Intronic
1013439662 6:110150179-110150201 GTTAAAATATAGAAAGTGAAAGG + Intronic
1013497848 6:110716835-110716857 TTTAATAAATAGAATGTGGCAGG + Intronic
1014103510 6:117537594-117537616 TTTAAACTACATAATCTGAAGGG - Intronic
1014353077 6:120368123-120368145 TCTAATATACAGAATTTAGAAGG + Intergenic
1014425005 6:121293614-121293636 TTTAAAATACAGTTTCTGCAGGG + Intronic
1014478641 6:121907221-121907243 ATTAATATACAGAATATGTAAGG - Intergenic
1014626879 6:123737297-123737319 TTTAACTTACAGACTGAGGAGGG + Intergenic
1014698842 6:124658046-124658068 TGTAAAATACAGCATGGGGTAGG + Intronic
1014892323 6:126857846-126857868 TTAAAAATGCAGAATGGGGCTGG - Intergenic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015267639 6:131304570-131304592 TTTAAAATACATAATTAGCAAGG - Intergenic
1015642267 6:135347936-135347958 TTTAAACTACAGAATAAGAAGGG + Intronic
1015832587 6:137386341-137386363 ATCAAAATACAGATTTTGGAGGG - Intergenic
1016067155 6:139696406-139696428 ATTAAAACACAGAATGTGTTTGG - Intergenic
1016081071 6:139856917-139856939 TTTAAAATATTGAAAGTAGATGG + Intergenic
1016454899 6:144220734-144220756 TTTAAAATAAACAGTGTGGCTGG + Intergenic
1016570713 6:145508770-145508792 TATAGAATTCAAAATGTGGATGG + Intronic
1017253483 6:152307419-152307441 GTTAAAATAGAGCATATGGAAGG + Intronic
1017589766 6:155966155-155966177 TTTAAAATACAGTATTTTGTTGG - Intergenic
1017821833 6:158054450-158054472 TTTAAAATACATATTGTTGCTGG - Intronic
1018602086 6:165555151-165555173 TTTAAAATAAAGAATGTAATTGG + Intronic
1019054344 6:169212646-169212668 TTTAAAATCCAGAATAAGTATGG + Intergenic
1019397882 7:832693-832715 TTCAAAATACAGCATGTAGTCGG - Intronic
1020088866 7:5326232-5326254 TTTAAAATACTGTGTGTGCATGG - Intronic
1020250302 7:6462500-6462522 TTTAAGATTCTGAATGTCGATGG - Exonic
1020374981 7:7474700-7474722 TTTAAAATTCAGATTTTGGTTGG - Intronic
1020409406 7:7874518-7874540 TTTAAAATACAAAATCAGGCCGG + Intronic
1020433542 7:8137861-8137883 TTTAATTTACAGAGTGTGCAAGG - Intronic
1020728437 7:11846951-11846973 TTTAAAATGCACAATTTTGATGG - Intergenic
1020892511 7:13896944-13896966 TTTAAAATACACAATGCACAGGG + Intronic
1021148706 7:17121979-17122001 TTTAAAAAATAGAATTTGAAAGG - Intergenic
1021422248 7:20458952-20458974 TTTAAAAAATTGAATGTGGTGGG - Intergenic
1021538752 7:21733440-21733462 TTCCAAATACATAAAGTGGAGGG - Intronic
1021774560 7:24039852-24039874 TTTAGACTACTGAATGTGGTTGG - Intergenic
1021960810 7:25871330-25871352 TTTTAAATAATGAATGGGGATGG + Intergenic
1022167734 7:27786727-27786749 TTAAATATACAGAATGCTGAAGG - Intronic
1022561045 7:31349851-31349873 TTTAAAATAAAAATTGAGGAAGG + Intergenic
1022642885 7:32204858-32204880 ACTACAATACAGCATGTGGAAGG - Intronic
1022808407 7:33845839-33845861 TTTAAAAAACTGATTATGGAAGG + Intergenic
1024516358 7:50262347-50262369 TTTAAAATCCAGGAAGTGCAGGG - Intergenic
1024842638 7:53604299-53604321 TATAAAATTCAGAATCTGCATGG + Intergenic
1024848097 7:53674229-53674251 TATTAAATACAGAATCTCGAAGG - Intergenic
1025057309 7:55775415-55775437 CTAAAAATACAAAATGTGGTGGG + Intergenic
1025779963 7:64592817-64592839 TTTAAAATACAAAAATTGGTTGG - Intergenic
1025805614 7:64830332-64830354 ATTAAAAAACAAATTGTGGAGGG - Intronic
1025909751 7:65818829-65818851 TTTAAAAAAAAAAATGTGGTTGG + Intergenic
1026031660 7:66799495-66799517 TGTAAAATGCAGATTGTCGAAGG + Intronic
1026145670 7:67744393-67744415 TTTACAATATAGAATGTGTCTGG - Intergenic
1026503466 7:70962543-70962565 ATTACAATCCAGAATGTGGGTGG + Intergenic
1027299620 7:76817456-76817478 ATGAAAATACAGAATGAGTAAGG + Intergenic
1027554525 7:79647436-79647458 CTTAAAATTCAGAATCTGGATGG - Intergenic
1027837947 7:83270006-83270028 TATAAAATGCAGAGTGTGGATGG + Intergenic
1027880387 7:83828153-83828175 TTTATCATATAAAATGTGGAAGG + Intergenic
1027904814 7:84165936-84165958 GTGAAAATATAAAATGTGGAGGG + Intronic
1028398404 7:90397678-90397700 TTTAAAATACATATTCTGGGAGG - Intronic
1028422742 7:90651557-90651579 TTTAAAATACATAATGTGTGAGG + Intronic
1028782200 7:94750277-94750299 TTTAATATACAAAATGTGGCTGG + Intergenic
1028783833 7:94769199-94769221 TTTAAAATACGGGATGTGCCGGG - Intergenic
1028980613 7:96964023-96964045 TTTAAAATTAAGTAAGTGGAAGG - Intergenic
1030248459 7:107412750-107412772 TTTAAAATACGGATTTTGAATGG - Intronic
1030497258 7:110315505-110315527 TTTAAAATACTGAGTATAGAAGG + Intergenic
1030554638 7:111008135-111008157 TTGAAAATAGAGAATGGGGAGGG - Intronic
1030697892 7:112605902-112605924 TTTAAAATACAAAAGATGGATGG - Intergenic
1030942545 7:115671607-115671629 TTTAAAAGACAGAAGAAGGACGG - Intergenic
1031529709 7:122861479-122861501 TTTAATATCCAGAATATGCAAGG - Intronic
1031536182 7:122936117-122936139 TTGAAGCTACATAATGTGGAAGG - Intergenic
1031772399 7:125861020-125861042 TTTAATATCCAGAATCTGTAAGG - Intergenic
1032213662 7:129939593-129939615 TTAAAAATTCAGAATTTGGTTGG - Intronic
1032215676 7:129955329-129955351 TTTAAAATACAAAAATTGGCTGG - Intergenic
1033120980 7:138666143-138666165 TTTTAAAGACAAAATGAGGAAGG - Intronic
1033774673 7:144594764-144594786 TTCAAAATCCAGAAGGGGGATGG + Intronic
1033955075 7:146837426-146837448 TTAAAAATGCAAAATGTTGAAGG - Intronic
1034513920 7:151558824-151558846 TTTGAAATACCAAATCTGGATGG + Intronic
1034536429 7:151728537-151728559 TTTAAAATAGTGACTCTGGACGG - Intronic
1035100538 7:156392551-156392573 ATTAAAATATAAAATGTGGCCGG + Intergenic
1035348185 7:158221841-158221863 TTTAATATCCAGAATCTGTAAGG + Intronic
1035410888 7:158640246-158640268 TTTAAAGTACAGAGAGTGGCCGG + Exonic
1036012195 8:4738601-4738623 TTTAAAATACAGATGCTAGATGG - Intronic
1036053189 8:5223628-5223650 TAGAAAATACAGAAAGTGGCTGG + Intergenic
1036410253 8:8493538-8493560 TTCAAATTAAAGAATGTTGATGG - Intergenic
1036504294 8:9341389-9341411 TTTAAAAGACAGAAAGAAGATGG + Intergenic
1036919910 8:12842445-12842467 TTTAAAATGCAGACTGTGCCTGG + Intergenic
1037029424 8:14084743-14084765 TTTAAAATACAGAATTGAAAAGG + Intergenic
1037414051 8:18629869-18629891 CTTACAATCCAGAATGTGCATGG - Intronic
1037496975 8:19449971-19449993 CTTAAAATCTAGAATATGGAAGG + Intronic
1038867266 8:31453257-31453279 TTTAAAATACATAATGGGACAGG - Intergenic
1039159584 8:34602541-34602563 TTTCAAATACATACAGTGGATGG - Intergenic
1039382698 8:37100682-37100704 TAAACAATTCAGAATGTGGAAGG + Intergenic
1039672200 8:39613647-39613669 CTTAGAATTCAGAATCTGGATGG + Intronic
1039940767 8:42088677-42088699 TTAAAAATACAGAATGGGCCAGG - Intergenic
1040026111 8:42784384-42784406 ATTAAAATAAAGAATCTGGCTGG + Intronic
1040492407 8:47936955-47936977 TATAAAATACAGTATCTGGCCGG + Intronic
1040811876 8:51462326-51462348 CATAAAATTCAGAATCTGGATGG + Intronic
1041352548 8:56962643-56962665 ATTAAAATAGAGAAGGTTGAAGG - Exonic
1041354579 8:56987034-56987056 TTTAAATTCCAGAAAGGGGAAGG + Intronic
1041369586 8:57144355-57144377 AATAAAATAAAGTATGTGGAAGG + Intergenic
1041567457 8:59295860-59295882 TCTCAATTACAGAATGTGGGTGG + Intergenic
1041653746 8:60327873-60327895 TTAAACATACAAAATGTAGAGGG + Intergenic
1041869858 8:62620364-62620386 TTTGAGAAACAGAATGTGCATGG - Intronic
1042017460 8:64330691-64330713 TATAAAATACAAAATTTAGAAGG - Intergenic
1042779677 8:72476751-72476773 TATAGAATTCAGAATATGGATGG + Intergenic
1043093284 8:75931426-75931448 TTTAACATCCAGAATCTAGAAGG + Intergenic
1044094138 8:88041485-88041507 TTTACAGTACAGTATGTGGCGGG + Exonic
1044360966 8:91283233-91283255 TTAAAAATACAGAAAGAGAAGGG + Intronic
1044643431 8:94411138-94411160 TTTATATTAAAGAATTTGGAAGG - Exonic
1044753540 8:95439077-95439099 ATTAAAATACTGATTGTGCATGG - Intergenic
1044856115 8:96477625-96477647 TTTAACATACGGATTTTGGAGGG + Intergenic
1045091518 8:98750239-98750261 TTTAAACTCCAAAATGTAGATGG + Intronic
1046169791 8:110490318-110490340 TTTAAAATAAAGAATGTAATTGG + Intergenic
1046479973 8:114803010-114803032 TTTAAAAAAAAGGATTTGGATGG - Intergenic
1047172678 8:122509279-122509301 AATAAAATATAAAATGTGGAAGG - Intergenic
1047670203 8:127137605-127137627 ATTAAAAAAGAGAATGTGTATGG + Intergenic
1048246410 8:132807377-132807399 TTTAAACTACAGAATGTCAAGGG + Intronic
1048413829 8:134204127-134204149 TTTAAAACACAGCAGGTGAAGGG - Intergenic
1048476739 8:134749651-134749673 TTTTACATACAGTATGAGGAAGG + Intergenic
1048619285 8:136113998-136114020 GTTAAAACACAGAATCTGGCCGG - Intergenic
1048883202 8:138887062-138887084 TTTAAAATAAAGAGTGTAGTTGG - Intronic
1050133789 9:2440742-2440764 TAAAAAATACAGGATATGGATGG - Intergenic
1050550758 9:6746562-6746584 TTTAAAATACAAAATGGGCCGGG - Intronic
1050814983 9:9799120-9799142 TTTAAAATATATAAATTGGAGGG - Intronic
1050970910 9:11872199-11872221 TTCAAATTACAGAATGAGGCTGG + Intergenic
1052003576 9:23318578-23318600 TTAAAAATACAAAAGGTAGATGG + Intergenic
1053296306 9:36916150-36916172 TTTAATATAAAGAGTGAGGAAGG + Intronic
1054921128 9:70543350-70543372 TTTTAAATAAAGAATGTAAATGG - Intronic
1055585191 9:77751710-77751732 TTGAAATTACAGGAAGTGGAAGG - Intronic
1055919899 9:81449324-81449346 TTTAAAAAATTGAATGTGGGAGG - Intergenic
1055924244 9:81493574-81493596 TTTAAAATAAAGCATGATGAAGG - Intergenic
1056094207 9:83234205-83234227 TTTAAAATAGAGAATCAAGATGG - Intergenic
1056218686 9:84429914-84429936 TTTAATCAAAAGAATGTGGAAGG - Intergenic
1056613828 9:88144333-88144355 TTTAAAATACATATTCTGCATGG + Intergenic
1056630984 9:88292820-88292842 TTTAAAATACAAAATTTAGCTGG + Intergenic
1056726364 9:89122629-89122651 TTTAACTAATAGAATGTGGAGGG - Intronic
1056733704 9:89186304-89186326 TTAGAAATACAGAATATGGAGGG - Intergenic
1056831019 9:89917684-89917706 TTGAAAATGAGGAATGTGGATGG - Intergenic
1057403064 9:94741569-94741591 TTTAAAAAAAAGAAGGGGGAAGG - Intronic
1057418410 9:94886504-94886526 TTTAAAATTCAGAATATAAATGG + Intronic
1057449118 9:95141011-95141033 TTAAAAAAACAGGATGTGGCTGG + Intronic
1057536878 9:95918751-95918773 TTTAAAAAACACAATGAGAATGG - Intronic
1057636095 9:96769117-96769139 TTTAAAATACAGTATAAGGTAGG - Intronic
1058191445 9:101921069-101921091 TTTAGAACACAAAAGGTGGAGGG + Intergenic
1058838621 9:108882929-108882951 TTTAATATCCAGAATATGTAAGG - Intronic
1058945744 9:109854339-109854361 TTTAAACTACAAAATATGCAAGG + Intronic
1059313470 9:113404673-113404695 TTGAAACTACAGAATTTGGCCGG - Intergenic
1059778973 9:117507112-117507134 CATAAAATTCAGAATCTGGATGG - Intergenic
1060095279 9:120783425-120783447 TTTAAGATACTGAATGGGGAGGG - Intronic
1060119780 9:120977714-120977736 TTTAAAATACAGATTGAGGCCGG - Intronic
1062065171 9:134522784-134522806 ATTAAAATAAAAAATGAGGAAGG - Intergenic
1062720424 9:138039344-138039366 TTTAAAAAACAGAATAAGCAAGG - Intronic
1186081608 X:5939235-5939257 TGTAAAACACTGCATGTGGAGGG + Intronic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1186588786 X:10905599-10905621 TTTAAAATATAGAACTTGGTTGG - Intergenic
1187029289 X:15469146-15469168 TTTTAAATTCAGATTGTGAAAGG + Intronic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187519722 X:20002881-20002903 TTTAAAATACATATTGAGGCCGG - Intergenic
1188096595 X:26031269-26031291 TTTAACATACAGAAGGTGAGTGG - Intergenic
1188279565 X:28248137-28248159 TTTCAAATACTGAATATGCACGG - Intergenic
1188396557 X:29691593-29691615 TTTAAAATCCAAAACTTGGAAGG + Intronic
1188629778 X:32340290-32340312 TCCAAAATTCAGAATGTGAAGGG - Intronic
1188751381 X:33909754-33909776 TCCAAAATACAGAATTGGGAAGG + Intergenic
1188869543 X:35357642-35357664 TTGAAAATAAAGAATGTTAAAGG - Intergenic
1188941252 X:36240873-36240895 TTTAAAAGAAAAAATGGGGAGGG + Intronic
1189422554 X:40869265-40869287 GTTAATATCCAGAATATGGAAGG - Intergenic
1189743422 X:44144726-44144748 TTCAAAATAGACAATGGGGAGGG + Intergenic
1192303893 X:69937629-69937651 TTTAAAAAACATGATGAGGAAGG - Intronic
1192756435 X:74050697-74050719 CATAAAATTCAGAATCTGGATGG + Intergenic
1192812121 X:74556356-74556378 TTTAAAATAAAGAGTGTAGTTGG + Intergenic
1193061984 X:77216387-77216409 TTTCAAATATAAATTGTGGAGGG + Intergenic
1193391637 X:80936381-80936403 TTTAAAATAGAGAGTGTAAATGG - Intergenic
1193472748 X:81926675-81926697 TATAGAATTCAGAATCTGGATGG + Intergenic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1194041126 X:88943199-88943221 TTTAAAATAAAGATTGTAGGTGG + Intergenic
1194047389 X:89024981-89025003 TTCAAAATACGTATTGTGGAAGG + Intergenic
1194100053 X:89693217-89693239 AATAGAATACAGAATCTGGATGG - Intergenic
1194412602 X:93575663-93575685 TTTAAAATACTTAATCTGGCTGG + Intergenic
1194655245 X:96565111-96565133 TTAAAAATGCAGATTGTGGTGGG - Intergenic
1194786573 X:98092184-98092206 TTTAATATCCAGAATCTGTAAGG - Intergenic
1195122129 X:101765500-101765522 TTTAAATTACAAAATGTGAATGG - Intergenic
1195198185 X:102519225-102519247 TTTAAAATTGAGATTATGGAGGG - Intergenic
1195488150 X:105434591-105434613 TCTAATATCCAGAATTTGGAAGG - Intronic
1196044473 X:111243156-111243178 TGTAATATACAGAATCTAGAAGG - Intergenic
1196058366 X:111381066-111381088 TTTAAGAAACAAAATGTTGATGG - Intronic
1196497555 X:116339419-116339441 TTTAATATACAGAATCTATAAGG + Intergenic
1196515372 X:116605190-116605212 TTTATAATTCAGAATCTGGATGG - Intergenic
1196681589 X:118475194-118475216 CTGAAAATACAAAATGTAGATGG + Intergenic
1196743733 X:119049044-119049066 AATAAAATTCAGAATGTGTATGG + Intergenic
1196751452 X:119121239-119121261 TTTGAAAAACAGCCTGTGGAGGG - Intronic
1197013216 X:121592446-121592468 TTTAAAATTCAGAATTTGCAAGG + Intergenic
1197412547 X:126137647-126137669 TTTAAAATTCAAAATATAGATGG - Intergenic
1197416605 X:126182373-126182395 TTTAATATACAGAATATACAAGG - Intergenic
1197582406 X:128299574-128299596 TATAGAATTCAGAATATGGATGG + Intergenic
1197620177 X:128738974-128738996 TTAAAAATACATAATGTGGCAGG - Intergenic
1198071442 X:133152328-133152350 TTTAAAATACAGGTTCTGGCCGG + Intergenic
1198104576 X:133450001-133450023 TAAAAAATAAAGAATTTGGAAGG + Intergenic
1198198346 X:134387976-134387998 TTAAAAATACAGCATTTTGAAGG - Intronic
1198602547 X:138299895-138299917 TTTTAATTACTGAAGGTGGAAGG + Intergenic
1198640882 X:138755237-138755259 TTTAATATCCACAATGTGCAAGG - Intronic
1198814297 X:140571107-140571129 TTTATAATAAAGAATGTCCAGGG + Intergenic
1198957990 X:142152821-142152843 TTTAATATAAAGAATATGTAAGG - Intergenic
1199126883 X:144133218-144133240 TTTGAAATAGAGAATATGGCAGG - Intergenic
1199188621 X:144944198-144944220 ATCAAAATACACAATGGGGAAGG - Intergenic
1199296403 X:146163711-146163733 TTTAAAATACAAAATGCAAATGG - Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1199405743 X:147457440-147457462 TTTAATATCCAGAATCTGTAAGG + Intergenic
1199520128 X:148725921-148725943 TTTAAAAAATAGAGTGTTGAAGG + Intronic
1199724045 X:150564865-150564887 TTTTAAATACAGACTGGGGTTGG + Intergenic
1199949267 X:152693502-152693524 TTTAATCTCCATAATGTGGATGG - Intergenic
1199951444 X:152709103-152709125 TTTAACTTCCATAATGTGGATGG - Intergenic
1199958239 X:152759358-152759380 TTTAACTTCCATAATGTGGATGG + Intergenic
1199960409 X:152774947-152774969 TTTAATCTCCATAATGTGGATGG + Intergenic
1200453055 Y:3354576-3354598 AATAGAATACAGAATCTGGATGG - Intergenic
1200875195 Y:8147102-8147124 TTTAAAATCCAGGAAGTGGCTGG - Intergenic
1201053862 Y:9968426-9968448 TTTAAAATCCAGGAAGTGGCTGG - Intergenic
1201514877 Y:14809164-14809186 ATTAAAAAATAAAATGTGGAAGG - Intronic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic
1201696229 Y:16829603-16829625 TTTAAGATACAGAACCTGGAAGG + Intergenic
1201773636 Y:17642231-17642253 CTTAAAATACAAAATTAGGAGGG - Intergenic
1201827920 Y:18263754-18263776 CTTAAAATACAAAATTAGGAGGG + Intergenic
1202187913 Y:22207297-22207319 TTTAAAATCCAGGAAGTGGCTGG - Intergenic
1202203447 Y:22379099-22379121 TTTAAAATCCAGGAAGTGGCTGG + Intronic
1202240227 Y:22759621-22759643 TTTAAAATCCAGGAAGTGGCTGG + Intergenic
1202393213 Y:24393375-24393397 TTTAAAATCCAGGAAGTGGCTGG + Intergenic
1202477572 Y:25276725-25276747 TTTAAAATCCAGGAAGTGGCTGG - Intergenic