ID: 951387283

View in Genome Browser
Species Human (GRCh38)
Location 3:22058055-22058077
Sequence TTGGCTATACACACCCTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951387281_951387283 -3 Left 951387281 3:22058035-22058057 CCAAACTAAAACAATTCTTGTTG 0: 1
1: 0
2: 0
3: 21
4: 246
Right 951387283 3:22058055-22058077 TTGGCTATACACACCCTTCTAGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951387283 Original CRISPR TTGGCTATACACACCCTTCT AGG Intronic
903491585 1:23732729-23732751 ATGACAATACACACCCTTTTTGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
909625414 1:77710239-77710261 GTGGTTATAAACACCATTCTTGG + Intronic
918107337 1:181426117-181426139 TTGGCTGGACACACCCAGCTTGG + Intronic
918972516 1:191437953-191437975 TTGGCTATGCAGACTCTTTTTGG - Intergenic
919203491 1:194390393-194390415 TTGGCTATGCCTTCCCTTCTTGG + Intergenic
920660685 1:207911718-207911740 TTGGCTGTCCAAACCATTCTTGG + Intergenic
924870208 1:248034316-248034338 TTGGCTATGCAGACTCTTTTTGG - Intronic
1066295800 10:34053504-34053526 TTTGCTATCCACACCCTTGCTGG + Intergenic
1068575580 10:58680693-58680715 TTGGCTATACAGGCTCTTTTTGG - Intronic
1069234060 10:66048145-66048167 TTGGCTATTCAGACTCTTTTTGG - Intronic
1069388808 10:67910716-67910738 TTTTATATACACACCCTTTTGGG - Intronic
1070427034 10:76298877-76298899 TCAGCTATATAAACCCTTCTGGG + Intronic
1072024349 10:91439554-91439576 TTGGCTATACAGGCTCTTTTTGG + Intronic
1072045313 10:91648820-91648842 TTGGCTATACAGGCTCTTTTTGG - Intergenic
1080303165 11:30807250-30807272 TTGGCTATACAGGCTCTTTTTGG + Intergenic
1085395177 11:76203510-76203532 TGGGCTGTCCACCCCCTTCTTGG - Intronic
1089355810 11:117852396-117852418 TTGGCTATGTACACAATTCTAGG + Intronic
1092666353 12:10803886-10803908 TTGGGTATTCACACCTTCCTGGG + Intergenic
1093737261 12:22635323-22635345 TGGTCTACACACACCCTTCTTGG - Intronic
1093903161 12:24660221-24660243 TTGTCTATACCCATCTTTCTTGG + Intergenic
1097855499 12:64457237-64457259 TTGACTATAAACACCCTTTATGG + Intronic
1098312095 12:69158631-69158653 TTGGATAGACACACCTTTCAAGG - Intergenic
1099491522 12:83293544-83293566 TTGTTTGTACACATCCTTCTTGG - Intergenic
1100591919 12:96037312-96037334 TTCTCTTTACACACTCTTCTTGG - Intronic
1107863833 13:44684358-44684380 TTGACTATAGTCACCCTGCTAGG - Intergenic
1109484895 13:63006036-63006058 TTGGCTATGCACACTCTTTTTGG - Intergenic
1110418943 13:75283061-75283083 TTGGCTATACAAACTCTTTGAGG + Intergenic
1111077301 13:83253914-83253936 TTGGCTATTCACGCTCTTTTTGG - Intergenic
1114971504 14:28035377-28035399 TTGGCTATTCAAACTCTTTTTGG - Intergenic
1121916090 14:97837963-97837985 TTGGATATAAACACCCTTTTGGG + Intergenic
1124241213 15:28029252-28029274 TTGGTTATACACAGCCTAATTGG - Intronic
1128209731 15:65887857-65887879 TGGACTATACACAGCCTTCTAGG - Exonic
1131959276 15:97772269-97772291 TTGTTTGTACACATCCTTCTTGG + Intergenic
1139187532 16:64824306-64824328 TTGGCTATATACATCCTTTTTGG - Intergenic
1139249080 16:65477480-65477502 TTGTCTATACATTTCCTTCTGGG - Intergenic
1140437774 16:74962260-74962282 TTGGCTATACAGGCTCTTTTTGG + Intronic
1140660310 16:77184242-77184264 TTGTCTTTACAAACCATTCTAGG + Intergenic
1141220562 16:82065581-82065603 CTGGTTATACACACCCTGCTGGG - Intronic
1144140460 17:12342498-12342520 TTGGCCACACACGCCCTTATGGG - Intergenic
1144399335 17:14880379-14880401 TTGGCTATTCAGGCCCTTTTTGG + Intergenic
1146242398 17:31242912-31242934 TTGTTTGTACCCACCCTTCTGGG + Intronic
1146432122 17:32807623-32807645 TGGGATACACACACACTTCTGGG + Intronic
1153071031 18:1104867-1104889 CTTGCTAAACCCACCCTTCTAGG + Intergenic
1157068558 18:44379737-44379759 TTGGCTATACAGGCTCTTTTTGG - Intergenic
1158468757 18:57714813-57714835 TTGTTTATACCCATCCTTCTTGG - Intronic
1159686101 18:71422905-71422927 TTGGCTATACAGGCCTTTTTTGG + Intergenic
926371722 2:12185340-12185362 TTGGGGGTACACACCCTTGTTGG + Intergenic
926516409 2:13851699-13851721 TTGGTTGTACCCATCCTTCTTGG - Intergenic
928408072 2:31030363-31030385 TTTGCTAAACATACCATTCTAGG + Intronic
929923343 2:46189237-46189259 TGTGCTAAACACATCCTTCTTGG - Intergenic
929925285 2:46202336-46202358 TTCTCTGTACACACCCTCCTTGG - Intergenic
930501875 2:52231843-52231865 TTGGCTATTCAGACACTTTTTGG - Intergenic
932648327 2:73529534-73529556 TTGTTTATACCCATCCTTCTTGG + Intronic
934923273 2:98363123-98363145 TTGGCTATACAAGCTCTTTTTGG + Intronic
939215964 2:139238770-139238792 TTTGTTATACACTCCCTCCTTGG - Intergenic
939860242 2:147411416-147411438 TTGGCTATACAGGCTCTTTTTGG + Intergenic
940315017 2:152319654-152319676 TTGTTTGTACCCACCCTTCTTGG + Intergenic
940603019 2:155884873-155884895 TTGGCTATACAAGCTCTTTTTGG - Intergenic
943087536 2:183331383-183331405 TTGGCTATACGCGCTCTTTTTGG - Intergenic
944524667 2:200606455-200606477 TTGGCTATACAGGCTCTTTTTGG + Intronic
945961320 2:216138208-216138230 TTGACTACACACACTGTTCTTGG + Intronic
946005856 2:216524347-216524369 TGGGCTATAGACAGCCTGCTGGG - Intronic
947834722 2:233167074-233167096 TTTGATATAAACACCCTGCTAGG + Intronic
1169348932 20:4852615-4852637 TTGGCTATATATACCTTTCTGGG - Exonic
1172304188 20:33870088-33870110 GAGGCCAGACACACCCTTCTGGG + Intergenic
1174127349 20:48316679-48316701 TTGGCAAGACAAACCCTTCAAGG + Intergenic
1176987218 21:15451314-15451336 TTGGCTATACAGGCTCTTTTTGG + Intergenic
1177024665 21:15907229-15907251 TTGGCTATATACACAATTCTTGG + Intergenic
1184869099 22:47222235-47222257 GTAGCTCTGCACACCCTTCTAGG + Intergenic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949714415 3:6912346-6912368 TTGGCTATGCAAACCTTTGTTGG + Intronic
951070054 3:18317177-18317199 TTGGCTATTCAGACTCTTTTTGG + Intronic
951070431 3:18321959-18321981 TTGGCTATTCAGACTCTTTTTGG + Intronic
951387283 3:22058055-22058077 TTGGCTATACACACCCTTCTAGG + Intronic
951438486 3:22693464-22693486 TTGTCTATGTACACACTTCTGGG + Intergenic
951454659 3:22876776-22876798 TTCTCTCTACAAACCCTTCTAGG + Intergenic
954351136 3:50044862-50044884 TTGGCTATATTGACCCTTTTTGG + Intronic
954466825 3:50660205-50660227 TTGTCTATATAAACTCTTCTAGG - Intergenic
956369421 3:68542228-68542250 CTGGCAACACACACACTTCTGGG + Intronic
958103692 3:89046986-89047008 TTGACTATTCACACATTTCTGGG + Intergenic
959428249 3:106219887-106219909 TTGGCTATACAGGCCTTTTTTGG + Intergenic
960207181 3:114917484-114917506 TTGTTTGTACCCACCCTTCTTGG + Intronic
964398295 3:156271815-156271837 TTGTCTGTACCCATCCTTCTTGG + Intronic
964635860 3:158858350-158858372 GTGGCTATAGACAGCCTTCCTGG - Intergenic
966369435 3:179232574-179232596 TTGGCTATTCAGACTCTTTTTGG + Intronic
967442388 3:189524197-189524219 TTGGTTATACAGACTCTTTTTGG - Intergenic
972093278 4:35316289-35316311 GTGGCAATACACCCCTTTCTGGG + Intergenic
972118115 4:35663985-35664007 TTGGCTATACAGGCTCTTTTTGG + Intergenic
978103942 4:104878112-104878134 TTAGCAATAGACACCCTCCTCGG + Intergenic
979892653 4:126119340-126119362 TTGCCTGTACCCGCCCTTCTTGG + Intergenic
980411616 4:132426858-132426880 TTGGCTATCCAGGCCCTTTTTGG + Intergenic
982452944 4:155573720-155573742 TTGGCTATACAGGCTCTTTTTGG - Intergenic
982719885 4:158848492-158848514 TTGTCTGTACCCACCCTTCTTGG - Intronic
986045995 5:4038890-4038912 TTGGCCCTACAGACCCTTGTGGG + Intergenic
987630246 5:20460526-20460548 TTGGTTGTGCACACCATTCTAGG + Intronic
987957124 5:24754653-24754675 TTGGCTATACAAGCTCTTTTTGG - Intergenic
993217330 5:85042886-85042908 TTGGCTATTCAGACTCTTTTTGG + Intergenic
993577517 5:89620784-89620806 TTGGCTATACAGGCTCTTTTTGG + Intergenic
996961382 5:129254719-129254741 TTGTCTATACATATCCTTCTAGG + Intergenic
997318674 5:132959710-132959732 CTCCCTATACATACCCTTCTTGG - Intronic
997452740 5:133996487-133996509 TTGGGGGTACACATCCTTCTTGG + Intronic
1000749629 5:165077974-165077996 GTGCCTATACACAGCCTTCCAGG + Intergenic
1001087744 5:168713533-168713555 TTGGCAATAATCACCCTTCAGGG + Intronic
1002592103 5:180297919-180297941 TTAGCTAAACACACAATTCTAGG - Intergenic
1003869702 6:10391662-10391684 ATGGATATACACACACTTGTGGG - Intergenic
1005585860 6:27275893-27275915 GTGGCTCTACTCACCCTTCAGGG + Intergenic
1006971409 6:38049497-38049519 CTGGTTACACACACCCTACTGGG + Intronic
1008145986 6:47891965-47891987 TTGGATATTCAAATCCTTCTGGG - Intronic
1008212920 6:48747311-48747333 TTTGCATTACAAACCCTTCTCGG + Intergenic
1014692574 6:124579124-124579146 TTGTTTGTACTCACCCTTCTTGG - Intronic
1020636383 7:10700535-10700557 TTGGCTATACACACTCTTTTTGG - Intergenic
1024956657 7:54927569-54927591 TTGTTTACACCCACCCTTCTTGG - Intergenic
1030508931 7:110458847-110458869 TTGGCTATACAGGCTCTTTTTGG - Intergenic
1030583351 7:111386767-111386789 TTGGTTATACATAACCTTCAAGG - Intronic
1041095163 8:54342573-54342595 CTGGCTACACAGCCCCTTCTTGG + Intergenic
1044131346 8:88527688-88527710 TTGGCTATACAGGCTCTTTTTGG - Intergenic
1044452563 8:92354691-92354713 TTTGCTATACAGACTCTTTTTGG + Intergenic
1044635344 8:94318849-94318871 TTGTTTGTACCCACCCTTCTTGG + Intergenic
1050283367 9:4075717-4075739 TTGCCTATGCATACACTTCTTGG - Intronic
1058206120 9:102110228-102110250 TTGGCTATTCACATTCTTTTTGG + Intergenic
1058347945 9:103986736-103986758 TTGGCTATTCATACTCTTTTTGG - Intergenic
1058888740 9:109342940-109342962 TTGCCTATACTCACCCTGCTGGG - Intergenic
1060277732 9:122194532-122194554 TTCCCTATGCACCCCCTTCTCGG - Intronic
1185631985 X:1521850-1521872 TGGGCTATAAACACTCTTCGCGG - Intronic
1186390954 X:9158590-9158612 TTTGCTGTATACACCCGTCTAGG - Intronic
1187637101 X:21241207-21241229 TTGACTATAGTCACCCTGCTGGG - Intergenic
1189690420 X:43612246-43612268 TTGTTTGTACCCACCCTTCTTGG + Intergenic
1189779104 X:44497107-44497129 TTGGCTATTCAGATCCTTTTGGG + Intergenic
1190934507 X:54984652-54984674 TTGGCTATACACACCTTAAGTGG - Intronic
1191701712 X:64048936-64048958 TTGGCTATACAAGCTCTTTTTGG - Intergenic
1192018946 X:67363667-67363689 TTGGCTATACATACGGTTTTTGG - Intergenic
1193209746 X:78792545-78792567 TTGGCTATACAAGCCCTTTTTGG - Intergenic
1193366477 X:80639591-80639613 TTGGCTGGACACACAATTCTTGG - Intergenic
1193636631 X:83958299-83958321 TTGGCTATACAGCTCCTTTTTGG - Intergenic
1196131422 X:112160988-112161010 TTGACTATAGTCACCCTGCTTGG - Intergenic
1196475784 X:116083784-116083806 TTGGTTATTCAGACCCTTTTTGG - Intergenic
1197073617 X:122329585-122329607 TTGGCTATTCAGTCTCTTCTTGG - Intergenic
1197506422 X:127310459-127310481 TTGGCTATATGCACTCTTTTTGG - Intergenic
1197984334 X:132251580-132251602 TTGGCTATACACACAGTAATGGG - Intergenic
1198009895 X:132541284-132541306 TTGACTATAGACACCCTGTTTGG + Intergenic
1198217672 X:134570624-134570646 TTGGCTATACAAATGCATCTAGG - Intronic
1199074110 X:143510473-143510495 TGGGGTATTCACTCCCTTCTGGG + Intronic
1199845430 X:151689305-151689327 TTGTTTGTACCCACCCTTCTTGG - Intergenic