ID: 951390128

View in Genome Browser
Species Human (GRCh38)
Location 3:22092366-22092388
Sequence CCACATCCACAGCTTTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951390123_951390128 13 Left 951390123 3:22092330-22092352 CCTACAACACAGCTTGTTTCTAC 0: 1
1: 0
2: 1
3: 18
4: 151
Right 951390128 3:22092366-22092388 CCACATCCACAGCTTTTGCAGGG 0: 1
1: 0
2: 1
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951390128 Original CRISPR CCACATCCACAGCTTTTGCA GGG Intronic
902185112 1:14719132-14719154 CCACAGACTCAGCTTCTGCAAGG + Intronic
902249470 1:15144587-15144609 CCACACCCAGGGCTTCTGCAGGG - Intergenic
904418489 1:30376854-30376876 CCACATTCACCACTTTTGAAAGG - Intergenic
904861079 1:33538263-33538285 ACACATCCACAGCTCTTGATGGG + Intronic
904869916 1:33610419-33610441 CCACATCCACAGGTGATGGATGG + Intronic
905562355 1:38937521-38937543 CCAGATTCTCAGCTTCTGCAGGG - Intronic
905718118 1:40170698-40170720 TCACCTCCAAAGGTTTTGCAGGG + Intronic
906459001 1:46023158-46023180 CTAGAGCCACAGCTTCTGCAAGG + Intronic
909593748 1:77381147-77381169 CCACATCAACAACCTTTGGAAGG + Intronic
912522076 1:110252411-110252433 GCCCAACCACAGGTTTTGCAGGG - Intronic
915650313 1:157305120-157305142 CAACCTCCCCAGCCTTTGCATGG - Intergenic
919771062 1:201158868-201158890 CCAGACCCACAGCTGTGGCACGG - Intronic
921271734 1:213475976-213475998 CAACATCCACATCTTTTCCCTGG + Intergenic
924905387 1:248446577-248446599 CCTCTTCCACAGCGTTAGCAGGG + Intergenic
924922502 1:248645459-248645481 CCTCTTCCACAGCGTTAGCAGGG - Intergenic
1067101230 10:43336183-43336205 CCACCTCCACAGCTCTGGGAAGG + Intergenic
1071855063 10:89615853-89615875 CTCCATCCACAGCTTGTGCATGG - Intronic
1072531048 10:96319750-96319772 ATACATCAACAGCTTTTGCTGGG + Intronic
1073148270 10:101294552-101294574 TCACATCCAAAGTGTTTGCAAGG + Intergenic
1076290487 10:129342128-129342150 TCAAGTCCATAGCTTTTGCAAGG - Intergenic
1076673568 10:132136282-132136304 CCACAGCCGCATCCTTTGCAAGG - Intronic
1076709517 10:132324263-132324285 ACACACCCCCAGCTTTTTCATGG + Intronic
1077323328 11:1952278-1952300 CCACAGCCTCAGCTACTGCATGG + Intronic
1078184077 11:9036788-9036810 CAACCTCCACAGCCTTTGCAAGG + Intronic
1084937910 11:72596827-72596849 CCACAGCAACAGCCTCTGCATGG + Intronic
1090113416 11:123940506-123940528 CCTCCTCCACAGCTTCTTCATGG - Exonic
1090956251 11:131515263-131515285 CCTCACCCACAGTGTTTGCAAGG + Intronic
1202806316 11_KI270721v1_random:7473-7495 CCACAGCCTCAGCTACTGCATGG + Intergenic
1092170956 12:6373907-6373929 CCACCTCCACAGCACCTGCACGG + Intronic
1093355884 12:18166379-18166401 CCAAATTCACAGCCTTTGGAAGG + Intronic
1093370862 12:18363512-18363534 CCTCATTCACAGCTCTTCCATGG + Intronic
1095356472 12:41280757-41280779 CCACATCCACCCCTTCTGCCTGG - Intronic
1096867517 12:54573691-54573713 CCACCTCTCCAGCTGTTGCAAGG - Exonic
1096990753 12:55800560-55800582 ACACATCAACAGTTTTTTCAGGG + Exonic
1105046859 12:133011404-133011426 CCACATTCAGAGCATTTCCATGG - Exonic
1108729846 13:53223776-53223798 TCCCATCCCCAGCTTTTGAATGG + Intergenic
1109454861 13:62572108-62572130 CTGCATACACAGCTTTTACAAGG - Intergenic
1110131667 13:72018973-72018995 CCATATGTACAGCTTTAGCAGGG - Intergenic
1110321758 13:74168259-74168281 CAATATGCACAGCTTTAGCAAGG + Intergenic
1114663080 14:24361518-24361540 CCTGATGCACAGCCTTTGCATGG - Intergenic
1118844094 14:69533341-69533363 CACCAACCACAGCTTTTGCCAGG - Intergenic
1119031944 14:71199711-71199733 CCACTTACACAGACTTTGCAGGG - Intergenic
1119043658 14:71298049-71298071 CCAAATCAACAGCATCTGCAAGG - Intergenic
1119506609 14:75178482-75178504 ACACATACACAGTTTTTTCATGG - Intergenic
1124175141 15:27417435-27417457 CCAGCTCCACAGCTTTGGCTGGG + Intronic
1124242051 15:28037003-28037025 TCACATCCACAGATTCTCCAAGG + Intronic
1124338419 15:28874323-28874345 CCACATTCACAGCTACTGGAGGG + Intergenic
1126420772 15:48469868-48469890 CTCCATCCAGAGCATTTGCAGGG + Intronic
1127298754 15:57632394-57632416 TCAGAACGACAGCTTTTGCAGGG - Intronic
1129438955 15:75565190-75565212 CCATTTCCACACCCTTTGCAGGG - Intronic
1129928345 15:79385694-79385716 CCACAGCCACAGTTTGGGCAGGG + Intronic
1132207716 15:99997943-99997965 CCACATTCAGAGCTTCTGCCGGG - Intronic
1132408487 15:101559724-101559746 CCACATCCACAGCCCTGGCTGGG - Intergenic
1132534780 16:472771-472793 CCACATCCACAGCTGCTGGGTGG - Intronic
1132825077 16:1900664-1900686 CCACACCCTGAGCTTTTGCAGGG + Intergenic
1133144955 16:3777883-3777905 CCACATCAACAGCTTCTGCAGGG + Intronic
1133425251 16:5682884-5682906 GCACTTCCACAGCTGTTTCATGG - Intergenic
1136776767 16:32875938-32875960 CCACATGCTCATCTTGTGCATGG + Intergenic
1136893851 16:33985575-33985597 CCACATGCTCATCTTGTGCATGG - Intergenic
1137671541 16:50282245-50282267 GCACAACCACAGCCCTTGCAGGG - Intronic
1140382607 16:74504059-74504081 TAACATCTACAGCTTTGGCATGG + Intronic
1141596832 16:85102267-85102289 ACACCTCCACCGCTTTGGCATGG + Exonic
1141935079 16:87233055-87233077 TCCCAGCCTCAGCTTTTGCATGG + Intronic
1203079182 16_KI270728v1_random:1138047-1138069 CCACATGCTCATCTTGTGCATGG + Intergenic
1142488606 17:262885-262907 ACACATCCACAGCCTTTACTGGG - Intronic
1146657808 17:34645327-34645349 CTGCTTCCACAGCTTCTGCAAGG + Intergenic
1147592265 17:41691725-41691747 CCACACCCACAGCTTCTCAACGG + Exonic
1148334205 17:46830938-46830960 ACACATTCAGAGCCTTTGCAGGG + Intronic
1152114390 17:78376458-78376480 CCACTTCCACAGATTATGCAGGG - Intergenic
1152125559 17:78444642-78444664 CACCATGCACAGCTTCTGCAGGG + Exonic
1152304924 17:79514848-79514870 CATCAACCACAGCTTCTGCACGG - Intronic
1152720205 17:81919857-81919879 CCAAATCCAAAGCTCTTGAAAGG + Exonic
1154048371 18:10929550-10929572 TCACATCCACAGCCTTTGAGGGG + Intronic
1155470238 18:26184163-26184185 CCAAATCCACAATTTTTCCAAGG + Intronic
1155876513 18:31096541-31096563 CCACACTCACATCTTTTGCTTGG + Intronic
1158312417 18:56172228-56172250 CTTCATCCACAGCTTTTACCTGG - Intergenic
1162100856 19:8337855-8337877 CCACCTTCACCCCTTTTGCAGGG - Exonic
1162681928 19:12351220-12351242 CCACACACACTGCTTTTACATGG + Exonic
1165262816 19:34635583-34635605 CCACATTCACTGCATTTGTAAGG + Intronic
1167779367 19:51588003-51588025 CCACATTCACTGCATTTGTAAGG - Exonic
1167840680 19:52115920-52115942 CCACATTCATTGCATTTGCAAGG + Exonic
1167876272 19:52415486-52415508 CCACATTCACTGCATTTGTAAGG - Exonic
925333312 2:3075275-3075297 CCAAATCCACAGTTCTTACAGGG - Intergenic
925773543 2:7308716-7308738 CACCTTCCACAGTTTTTGCAAGG + Intergenic
926070509 2:9884813-9884835 CCACGTCCACAGCTGTGGCTTGG - Intronic
926158885 2:10474340-10474362 CCACACCCACAACCTCTGCAGGG + Intergenic
926687693 2:15710666-15710688 CTACATCCCCAGCTCCTGCAGGG - Intronic
927285325 2:21351435-21351457 CAACATCCACAGAATCTGCAAGG - Intergenic
928529161 2:32173266-32173288 TCACATAAACAGCTTTTACAAGG + Intronic
928797593 2:35040704-35040726 TCACATCCAGAGCTGATGCAAGG - Intergenic
929002435 2:37361373-37361395 ACACATCCACATCCTTTGCCTGG + Intronic
931334896 2:61329652-61329674 CCACATCCAGAGATTCTTCATGG - Intronic
931672803 2:64663826-64663848 CCACAACTACAGCTTCTGCCAGG + Intronic
932131279 2:69189616-69189638 CCACCTCCACAGCTCCTGCCTGG - Intronic
932916346 2:75862757-75862779 CCACGTACTCAGGTTTTGCAAGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936226180 2:110654939-110654961 CCATATCCACAAGTTCTGCAGGG + Intronic
937969299 2:127536920-127536942 CTGCATCCACAGCTCTAGCACGG + Intronic
938119123 2:128621455-128621477 CCACCTCAACAGCTCATGCATGG + Intergenic
938929308 2:136072397-136072419 CCACATTTACATCTTTTGTATGG - Intergenic
942853159 2:180514658-180514680 CAAAATCCACAGCTATGGCAGGG + Intergenic
944060151 2:195563336-195563358 TCACATTCACAGCTTGGGCAGGG - Intergenic
945054098 2:205852917-205852939 CAACATCAACAGCTATTTCATGG + Intergenic
948620866 2:239233337-239233359 CCAAATCCAAAACTTTTTCACGG + Intronic
1172494840 20:35373059-35373081 CCAGTTCCACAGGTTTTGGAAGG - Intronic
1172883793 20:38218154-38218176 CCACCTCCACAGCTTTGCCCTGG + Intronic
1173619834 20:44428510-44428532 CCCCATCCTCACCCTTTGCAAGG - Intronic
1173870380 20:46338022-46338044 CGACATCCACAGCTGATGCAGGG + Intergenic
1176901991 21:14453472-14453494 CCACATCCACACCCTATGCAAGG - Intergenic
1179821909 21:43942009-43942031 CCTCACCCACAGCGTTTCCAAGG + Intronic
1180187140 21:46145577-46145599 CCACATCCACCCCTCTCGCAGGG - Exonic
1181442423 22:22943565-22943587 CCACATCCAGAGCTGTTGAATGG - Intergenic
1182725735 22:32443739-32443761 CCACATCTGCAACATTTGCATGG + Intronic
1182791186 22:32954331-32954353 CCACCTCCAGAGCTTTTAGAAGG + Intronic
1183144112 22:35973623-35973645 CCACATACAAAGTTTTTGCCAGG + Intronic
1183900626 22:41003233-41003255 CCCCAGCCACAGGTTTTCCAGGG + Intergenic
1183980354 22:41536089-41536111 CCACCTCCAGAACTTTTTCACGG - Intronic
1184357957 22:43995331-43995353 CCAAATCCTCAGCTTGGGCAAGG + Intronic
1184499487 22:44863210-44863232 CCATATCCACCCCCTTTGCAGGG - Intergenic
950290891 3:11783406-11783428 CCAAATCCAAAGCTTTTCCCAGG + Intergenic
951390128 3:22092366-22092388 CCACATCCACAGCTTTTGCAGGG + Intronic
952162511 3:30708046-30708068 CCACATTAACAGCTTTTTCTTGG - Intergenic
952271692 3:31839069-31839091 CTGCATTCATAGCTTTTGCAAGG - Intronic
952924371 3:38310421-38310443 TCAGATCCACAGCTTTTTCCTGG + Intronic
953642469 3:44722033-44722055 CCACATTCACTGCATTTGTAGGG - Exonic
955046026 3:55360543-55360565 CTACAGCCACAGCTTTTCCTGGG + Intergenic
957581935 3:82085305-82085327 GCACATGCACAGCTCTTGAAAGG + Intergenic
958916231 3:100053591-100053613 TCACATTCACAGGTTTTGCTAGG + Intronic
960473885 3:118100386-118100408 AAACATCCCCAGATTTTGCAGGG - Intergenic
961023055 3:123526065-123526087 CCACAGCAACAGCCTTTTCAAGG + Intronic
961023063 3:123526119-123526141 CCACAGCAACAGCCTTTTCAAGG + Intronic
961698559 3:128724003-128724025 CCTCATCCCCAGGTTTGGCAGGG - Intergenic
962359250 3:134723585-134723607 CCACATGCACAGCTTTCAAATGG - Intronic
962908889 3:139829737-139829759 CCAGATCATCAGCTTCTGCAGGG + Intergenic
962955113 3:140258494-140258516 ACACATTCACTGCTTTTCCAAGG - Intronic
963360946 3:144271291-144271313 CCACATCTCCAGCTTTATCAAGG - Intergenic
975200716 4:71584941-71584963 TCACATGCACAGCTTTCACAAGG + Intergenic
977767684 4:100819619-100819641 CTGCATCGCCAGCTTTTGCATGG - Intronic
984651667 4:182277259-182277281 CCAAATCCACAGATTTTTCCTGG + Intronic
986780417 5:11060149-11060171 TCACAACCACAGCATTTGCAGGG + Intronic
990784946 5:59408663-59408685 CTGCCTCTACAGCTTTTGCAAGG - Intronic
991664351 5:68983187-68983209 CCACAGCCACAGCTTTAGCCTGG - Intergenic
996969512 5:129346803-129346825 TCCCATCAACAGCTTGTGCAAGG + Intergenic
998883351 5:146668003-146668025 TCACATCCACACCTTTTCCTAGG + Intronic
1000279441 5:159769493-159769515 CTACATCCTCACCCTTTGCAGGG + Intergenic
1000477761 5:161732587-161732609 GCACACCCACTCCTTTTGCAGGG + Intergenic
1001654932 5:173342130-173342152 CCACATCCACAGTTCATGGAAGG - Intergenic
1005784993 6:29235953-29235975 CCACTTCAACAGCTTTTCAAAGG - Intergenic
1006909268 6:37553582-37553604 ACACATCAATAGCATTTGCAAGG - Intergenic
1007114441 6:39333611-39333633 ACACATCCAAAGCTTTGTCATGG - Exonic
1007142062 6:39585999-39586021 CCTCATACACAGATTTTGGAAGG - Intronic
1007515419 6:42406767-42406789 CCTCCTCCCCAGCCTTTGCAGGG + Intronic
1009963182 6:70549476-70549498 CCACATCCACAGTATCTCCAAGG - Intronic
1013216679 6:108033693-108033715 CCACATCGACAGCTTTCCCAGGG + Intergenic
1015896840 6:138025902-138025924 GCACAGCCACAGCCCTTGCATGG - Intergenic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1019295471 7:271883-271905 CCACATCCTCAGCCTCTGCCTGG - Intergenic
1019744242 7:2690703-2690725 CCACAGCGACAAGTTTTGCAGGG - Intronic
1027909532 7:84231615-84231637 CCACATCAGCAGCTTTCCCATGG - Intronic
1028225761 7:88250637-88250659 CCACATCCAGATCTTTTGGTGGG - Intergenic
1028672396 7:93418079-93418101 TCACATCCACATCTTCAGCAGGG + Intergenic
1030161918 7:106518011-106518033 CCACAGAAACAGCTTTTGCAAGG + Intergenic
1035041933 7:155935450-155935472 CCAGTTCCACAGCTTCTGGATGG - Intergenic
1035658539 8:1330112-1330134 CCACAGCCACACCTCTCGCAGGG - Intergenic
1035740807 8:1927079-1927101 TCACATCCACAGCTCCTGCTTGG + Intronic
1038395784 8:27244534-27244556 CCACACCCCCAGCATTTGCCAGG + Intronic
1041094216 8:54333157-54333179 CCAGCTCCACAGCTCTTTCATGG - Intergenic
1041611552 8:59855761-59855783 GCACATCATCAGATTTTGCAAGG + Intergenic
1043867032 8:85387038-85387060 CCACAACCACAGCTAGTCCATGG - Intronic
1044138376 8:88616425-88616447 CCACATCCACTGCAATTGAAGGG - Intergenic
1044391754 8:91660642-91660664 CCAAAGCCACATCCTTTGCAGGG + Intergenic
1044780840 8:95741767-95741789 TCCCATCCAGAGCCTTTGCAGGG - Intergenic
1044790335 8:95840448-95840470 GCACATCCAAATCTTTAGCATGG - Intergenic
1045371512 8:101529046-101529068 CCACGTCAACAGTTTTTTCAGGG + Intronic
1045383169 8:101646850-101646872 CCACCCCCACAGCTTTCCCAGGG - Intronic
1046573244 8:115992988-115993010 CCACCTGCACAGCTTGTGCTGGG + Intergenic
1046601734 8:116325052-116325074 CCACAGCCACAGATTCTGCCTGG + Intergenic
1047538790 8:125743854-125743876 CCAAATCCACAGCTGTTTCCAGG - Intergenic
1049496401 8:142936275-142936297 TCACAGCCACAGCTTTCTCAAGG + Intergenic
1053122009 9:35554700-35554722 CCAAACCCACAGCTTTAGCCTGG - Intronic
1053130802 9:35614399-35614421 GCCCATCCTCATCTTTTGCAAGG - Intronic
1053346956 9:37385051-37385073 CCACATTCAGAACTTTTGAAAGG - Intergenic
1203759635 EBV:5428-5450 CCACTTCCACAGCAATGGCACGG + Intergenic
1186393453 X:9183806-9183828 ACACTTCCACATCTTTTCCAAGG + Intergenic
1187196720 X:17093273-17093295 TCACACACACAGCTTCTGCAAGG - Intronic
1189255713 X:39637368-39637390 CCACCTTCACTGCTTGTGCATGG - Intergenic
1190092165 X:47448688-47448710 CCACATTCACTGCATTTGTAGGG + Exonic
1193509778 X:82384553-82384575 CCAGAACCACAGCTGTGGCAGGG + Intergenic
1196050889 X:111302912-111302934 ACACCTTCACAGCTTTTGCATGG + Intronic
1197172500 X:123449984-123450006 CCACATCCACTGCCTTTGTGTGG - Intronic
1198054070 X:132976484-132976506 CCACATACACAGATTTTGATGGG + Intergenic
1200103092 X:153698094-153698116 CCACATGCTCATCTTGTGCACGG - Intergenic