ID: 951391840

View in Genome Browser
Species Human (GRCh38)
Location 3:22114615-22114637
Sequence TGTCTTCTAATGGCCACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951391840_951391844 16 Left 951391840 3:22114615-22114637 CCACTGGTGGCCATTAGAAGACA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 951391844 3:22114654-22114676 TCTCAGAGTTCTCCCAGGTCAGG 0: 1
1: 0
2: 2
3: 28
4: 267
951391840_951391843 11 Left 951391840 3:22114615-22114637 CCACTGGTGGCCATTAGAAGACA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 951391843 3:22114649-22114671 TTATATCTCAGAGTTCTCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 197
951391840_951391849 30 Left 951391840 3:22114615-22114637 CCACTGGTGGCCATTAGAAGACA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 951391849 3:22114668-22114690 CAGGTCAGGGGTGAAGATGCTGG 0: 1
1: 0
2: 1
3: 23
4: 304
951391840_951391845 17 Left 951391840 3:22114615-22114637 CCACTGGTGGCCATTAGAAGACA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 951391845 3:22114655-22114677 CTCAGAGTTCTCCCAGGTCAGGG 0: 1
1: 0
2: 3
3: 39
4: 268
951391840_951391846 18 Left 951391840 3:22114615-22114637 CCACTGGTGGCCATTAGAAGACA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 951391846 3:22114656-22114678 TCAGAGTTCTCCCAGGTCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951391840 Original CRISPR TGTCTTCTAATGGCCACCAG TGG (reversed) Intronic