ID: 951397086

View in Genome Browser
Species Human (GRCh38)
Location 3:22181891-22181913
Sequence TCCCTGTGAAGAGGATCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951397086 Original CRISPR TCCCTGTGAAGAGGATCATG TGG Intronic
900500279 1:3001162-3001184 AGCCTGTGAAGGGGATCTTGAGG + Intergenic
900912163 1:5606183-5606205 TCAATGTGAAGATGATCATGAGG - Intergenic
901110199 1:6786959-6786981 TCACTGGGAAAAGGGTCATGTGG + Intronic
902368491 1:15991860-15991882 GGCCAGAGAAGAGGATCATGGGG - Intergenic
904231175 1:29074238-29074260 TTCCTGTGAAGAGGAATATAAGG - Intronic
904840222 1:33367781-33367803 TCCCAGTGAGGGGGAGCATGGGG + Intronic
904902838 1:33870893-33870915 GCCCTATGGAGAGGCTCATGTGG + Intronic
905644733 1:39617272-39617294 TCCCTGTGAGGAGGGGCCTGGGG - Intergenic
907051445 1:51331985-51332007 TACATGTAAAGAGGATGATGAGG + Intronic
908053055 1:60253821-60253843 TTACTGTGGAGAGGATGATGAGG + Intergenic
915129792 1:153688367-153688389 TACTTGCGAAGAGGGTCATGAGG - Intronic
917752807 1:178069108-178069130 TCCCTATGGAGAGGCCCATGCGG - Intergenic
919126558 1:193401410-193401432 GCCCTGTGGAGAGGTCCATGTGG + Intergenic
919552978 1:199015414-199015436 TCCCCTTGATGAGTATCATGAGG + Intergenic
921624529 1:217363724-217363746 GCCCTGTGGAGAGGCCCATGTGG + Intergenic
922019946 1:221693619-221693641 TCCCTATGAAGAGGTCCATGTGG + Intergenic
922684820 1:227631002-227631024 TCCCCTTGAAGAGGATATTGTGG + Intronic
924677719 1:246197283-246197305 TCCCTGTGACGAGGACAGTGTGG + Intronic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1064980466 10:21161625-21161647 TGCCTGTGAACAGGAACAGGGGG - Intronic
1066059212 10:31707363-31707385 TCCCGGGGAACAGGGTCATGCGG + Intergenic
1066499988 10:35983654-35983676 TCCCTAAGAAGAGGCTCATCAGG + Intergenic
1067559101 10:47292203-47292225 TCTCAGTGATGAGGTTCATGGGG + Intergenic
1067815788 10:49475834-49475856 ATCTTGTGGAGAGGATCATGAGG - Intronic
1069194595 10:65534507-65534529 TTCCTGTAAAGAGAATCATAAGG + Intergenic
1071613304 10:87051710-87051732 TACATGTGAAGAGGATAGTGAGG + Exonic
1074161437 10:110839799-110839821 TCCCTGTGAAGATGAATATCTGG + Intergenic
1075291201 10:121232662-121232684 GCTCTGTGAAGAGGGCCATGTGG - Intergenic
1076088073 10:127653433-127653455 GCCCTGTGGAGAGGCCCATGGGG + Intergenic
1077200679 11:1305972-1305994 CCCCTGTGAGGAGTATCATGGGG - Intronic
1078002419 11:7508156-7508178 TCATTGTGAAGAGGATGATGCGG - Intronic
1078391825 11:10941556-10941578 GCCCTATGAAGAGGTCCATGTGG + Intergenic
1079869352 11:25777711-25777733 TCCCTATGCAGAGGCCCATGTGG + Intergenic
1080796331 11:35567208-35567230 TTCCTGTGAGGAGGATCCTGGGG + Intergenic
1082189363 11:49224139-49224161 TCCTTGTGAAGAAGAGAATGGGG + Intergenic
1083623250 11:64059273-64059295 GCCCTGTGAAGAGGGTCTTGCGG + Intronic
1084038686 11:66529359-66529381 TCCCTGTGGAGATGAGCAGGAGG + Intronic
1084360462 11:68665579-68665601 TGCCTGTCAAGAGAATCATGAGG - Intergenic
1084669209 11:70595433-70595455 TCCCTGAGATGAGGCTCCTGAGG + Intronic
1086011944 11:82115338-82115360 TCTTTGTGAAGAGGCACATGAGG + Intergenic
1086677161 11:89622357-89622379 TCCTTGTGAAGAAGAGAATGGGG - Intergenic
1088235671 11:107720331-107720353 TCTCTGTGAAGAAGTTCATTTGG + Intergenic
1089355713 11:117851361-117851383 CCCCTGTGGAGAGGCCCATGTGG + Intronic
1089620297 11:119718259-119718281 TCCCAGGGAAGAAGATCACGGGG - Intronic
1089775815 11:120835029-120835051 TCACTTTCAAGAGGATGATGTGG - Intronic
1094402206 12:30074341-30074363 TACCTGTGAGGAAGAACATGTGG + Intergenic
1095203018 12:39407765-39407787 TCATTGTGAATAGGAACATGAGG - Intronic
1095627582 12:44334721-44334743 TCCTCGTGGAGAGCATCATGTGG - Intronic
1098021328 12:66159327-66159349 GCCCTATGGAGAGGTTCATGTGG + Intronic
1098192856 12:67968571-67968593 TTCATCTCAAGAGGATCATGGGG - Intergenic
1098581326 12:72102728-72102750 CCCCTGTGAAGATGAACATGAGG + Intronic
1099599551 12:84715926-84715948 ATCCTGTGAAGAGGATGAGGAGG + Intergenic
1100218916 12:92482755-92482777 GCCTTGTGGAGAGGCTCATGTGG + Intergenic
1101327020 12:103724429-103724451 TGCGTGTGTAGAGGAACATGGGG + Intronic
1101918653 12:108915516-108915538 TCCCTGTGAAGAAAATCCTTGGG - Intronic
1103170714 12:118817101-118817123 ACCCTGTGCAGAGGCACATGTGG + Intergenic
1104356584 12:128092104-128092126 TCGCTGTGAAGAGGATGACGTGG - Intergenic
1105001967 12:132695878-132695900 GCCCTGTGAAGAAGAACCTGAGG - Exonic
1105786897 13:23759209-23759231 TTCCTGTTAGGAGGATCAGGAGG + Intronic
1106673713 13:31934660-31934682 TCCATGTGAATGGCATCATGGGG - Intergenic
1106971767 13:35149231-35149253 TCCCTATGCAGAGTATAATGAGG + Intronic
1107283834 13:38767002-38767024 TCCATGAGAAGAGTACCATGAGG + Intronic
1108688743 13:52844771-52844793 TCCCTGCGCAGAGGATCCCGAGG + Exonic
1110143826 13:72165457-72165479 TCTCTGTCAAGAGTTTCATGAGG - Intergenic
1111256109 13:85670679-85670701 TCCCTGGGAAGAGGATGGAGTGG + Intergenic
1116138373 14:40956999-40957021 TGCCTATTAAGATGATCATGTGG + Intergenic
1119527324 14:75333138-75333160 TCCCTGAGAGGACGATCAAGAGG - Intergenic
1121505097 14:94471107-94471129 TGCTTGTGAAAAGGATGATGGGG - Intronic
1121649023 14:95543229-95543251 TCTCTGTGGAGTGGATGATGAGG - Intronic
1122320776 14:100854509-100854531 TCCCTGGGAAGTGGGTGATGGGG + Intergenic
1124140474 15:27072859-27072881 TCCCTGTGGAGTGGAAAATGTGG + Intronic
1125452305 15:39822054-39822076 GTCCTATGAAGAGGCTCATGTGG + Intronic
1125970441 15:43907076-43907098 TCCCTGTGGAGAGCTTCACGTGG - Intronic
1126438807 15:48664846-48664868 TCCCTGAGAAGAGGCCCATATGG - Intergenic
1126662946 15:51049794-51049816 CCCCTGTTAAGAGGCTGATGAGG + Intergenic
1126736669 15:51737695-51737717 CCCCTGTGAAGAGGAAGAGGCGG - Exonic
1128491008 15:68144407-68144429 TTTCTGTGAAGTGGTTCATGGGG - Intronic
1133052248 16:3123928-3123950 TCCCTGGGTAGAGGATGAGGAGG + Intergenic
1133415567 16:5604475-5604497 TGCCTGTGGAGAGGGCCATGTGG - Intergenic
1133659899 16:7906131-7906153 TCCCTATGAATAGGATTCTGAGG - Intergenic
1134123878 16:11603158-11603180 TCCCTCTGAAGAGGAGGAGGGGG + Intronic
1134650875 16:15907816-15907838 TCCCTGAGAAGATGATGTTGGGG + Intergenic
1135034675 16:19067336-19067358 TCCTGGGGAAAAGGATCATGAGG - Intergenic
1137538433 16:49345014-49345036 TCACTGTGAAGGCAATCATGGGG + Intergenic
1138025088 16:53515937-53515959 GCCATGCCAAGAGGATCATGGGG - Intergenic
1138751860 16:59432048-59432070 TGCTTGTGAAGAGGTTAATGGGG - Intergenic
1139316143 16:66070698-66070720 GCCCTCTGAAGAGGCTCATATGG - Intergenic
1139396103 16:66640441-66640463 TCCCTGGGAAGGGGGTCAGGTGG + Intronic
1140619106 16:76706168-76706190 TCCCTGTGAGGATGACCTTGTGG + Intergenic
1142712280 17:1730159-1730181 TGCCTGTGGAGAGGAACCTGCGG + Intronic
1143354870 17:6319431-6319453 ACCCTGTGGAAAGGTTCATGTGG - Intergenic
1143588541 17:7865541-7865563 GCCCTGTGTAGAGGCCCATGTGG - Intronic
1143684616 17:8503964-8503986 TCACTGTGGAGAGCAGCATGGGG - Intronic
1146540760 17:33692252-33692274 TTCCTGTGAAGAGGGTGAAGAGG - Intronic
1146915297 17:36674452-36674474 GCCCTGTGCAGAGGCCCATGTGG + Intergenic
1148512128 17:48180207-48180229 TCCATATGAAGAGGATGAGGAGG - Exonic
1148841890 17:50504058-50504080 TCCCTGGGAAATGGATGATGCGG + Intergenic
1150678076 17:67261981-67262003 TTCTTGTGAAGAGAATCATAGGG - Intergenic
1151216164 17:72577784-72577806 TCACTGTGAAGATGACGATGGGG + Intergenic
1153313951 18:3703909-3703931 TGCCTGTGAAGGGGAACGTGGGG - Intronic
1155336118 18:24767064-24767086 TCCCTGTGAACAGCAGCATTGGG - Intergenic
1156655284 18:39277979-39278001 TCACTCTGAAGATGATAATGCGG + Intergenic
1157491824 18:48128921-48128943 ACCCTGAGAAGGGGACCATGTGG + Intronic
1160314406 18:77827808-77827830 TCCCTGAGCAGAAGTTCATGTGG + Intergenic
1160553006 18:79707097-79707119 CCCCAGTGAGGAGGAGCATGTGG + Intronic
1160671295 19:365004-365026 GCTCTGTGAAGAGGCTCCTGGGG + Intronic
1161567232 19:5010311-5010333 TCCCTGTGCAGTGTATCAGGAGG + Intronic
1163491725 19:17620720-17620742 GCCCTGTGGAGAGAATCAGGTGG + Exonic
1164539199 19:29109714-29109736 TCCCTGTGAAGGCCATCATTTGG + Intergenic
1166864935 19:45830090-45830112 GCGCTGTGAAGCGGATCCTGCGG - Exonic
1166971078 19:46568321-46568343 TGCCTGGGGAGAGGCTCATGGGG - Intronic
1168339057 19:55613573-55613595 ACCCTGTGAAGAGGAGGACGGGG - Exonic
926393348 2:12416779-12416801 TCCCTGTGAAGTGGAGACTGGGG + Intergenic
926776107 2:16424821-16424843 TCCCTGTGGAGAGGTTCACATGG - Intergenic
927039974 2:19219129-19219151 TCCCTGTGGAAAGGACCATGTGG - Intergenic
927216269 2:20669369-20669391 TCCCTTTGAAGGGGGTCATATGG - Intronic
927825918 2:26310235-26310257 GCCCTGAGAAGAGGGACATGGGG + Exonic
929521715 2:42658623-42658645 TCCCTGTGGAAAGGAGCTTGAGG + Intronic
929812769 2:45205752-45205774 GCCCTGCTAAGAGGAGCATGTGG - Intergenic
930115238 2:47712526-47712548 TCCATGTTAGGAGGGTCATGGGG + Intronic
930860864 2:56071391-56071413 TCCCTGTGGAGAGGAGGATCTGG - Intergenic
931146345 2:59523475-59523497 TGCCTGGGAAGAGGATTATCCGG + Intergenic
931873970 2:66491895-66491917 TCCCTTTGAAAAGAATCATTTGG - Intronic
932185940 2:69695537-69695559 TCACTGTCAAGAAGAGCATGCGG - Intronic
932713017 2:74081579-74081601 TCCCAGTGAGGAGAATCATGTGG + Intronic
932875514 2:75447092-75447114 GCCCTGTGAAGAGGTCAATGAGG - Intergenic
933657178 2:84898650-84898672 GGCCTGTGAAGAGGCCCATGTGG - Intronic
934051732 2:88216893-88216915 GCCCTGTGGAGAGGCCCATGTGG + Intergenic
937036752 2:118788493-118788515 ACACTGGGAAGAAGATCATGTGG - Intergenic
938934186 2:136114931-136114953 TTCCTTTGGAGAGGATCTTGAGG + Exonic
939508086 2:143073859-143073881 GCCCTTTGGAGAGAATCATGTGG + Intergenic
944707448 2:202305474-202305496 TGCTTGTGAAGAGGTTTATGTGG + Intergenic
945190954 2:207186918-207186940 GCCCTGTGCAGAGGACTATGTGG - Intergenic
1171438930 20:25146293-25146315 TCCTTGCTAAGGGGATCATGGGG - Intergenic
1172479686 20:35263771-35263793 TCCCTGTGGAGAGGAGTGTGGGG - Exonic
1172534602 20:35663951-35663973 TCCCTCGGGAGAGGATCCTGTGG - Intronic
1173531042 20:43769761-43769783 TGGCTGTCAGGAGGATCATGGGG + Intergenic
1173537385 20:43825998-43826020 TCCCTTTGAAAAGGATCTTTGGG + Intergenic
1174700764 20:52606173-52606195 TCCCTGTGAATAGGTACATCTGG - Intergenic
1175389098 20:58615151-58615173 CCACAGTGAAGAGGATCCTGGGG - Intergenic
1178562447 21:33651430-33651452 TCTTTGTGATGAGGATAATGTGG + Intronic
1178774640 21:35538074-35538096 TCCCTCTGATGAGGGTCAAGAGG + Intronic
1179185544 21:39082921-39082943 ACCCTGTGACGACGATCATTAGG + Intergenic
1180799139 22:18623740-18623762 TCCCGGGGAGGAGGCTCATGAGG - Intergenic
1181222579 22:21371526-21371548 TCCCGGGGAGGAGGCTCATGAGG + Intergenic
1182008276 22:26979459-26979481 TCCCTATGTAGAGTATAATGAGG + Intergenic
1182787073 22:32916989-32917011 TCCCTGAGATGAGCCTCATGGGG - Intronic
1183164777 22:36139474-36139496 TCCCTGGAAGAAGGATCATGAGG + Intergenic
1183355707 22:37358171-37358193 GCCATGTGAATAGGATCACGGGG - Intergenic
949855717 3:8459223-8459245 GTCCTGTGAAGCAGATCATGGGG - Intergenic
950883955 3:16346804-16346826 ACCTTGTGAGGAGGATCATAAGG + Intronic
951397086 3:22181891-22181913 TCCCTGTGAAGAGGATCATGTGG + Intronic
951622295 3:24616262-24616284 ACACTGTAAAGAGGCTCATGAGG + Intergenic
951708432 3:25566778-25566800 TCCCTGTGGATGGGATTATGGGG + Intronic
951750440 3:26028745-26028767 TCCCTGTGGAGAGGAGCATCTGG - Intergenic
953985917 3:47442891-47442913 ACCCTGTGAAGAGGATGATGGGG + Exonic
954114409 3:48457634-48457656 TCCATGTGCAGAGGCCCATGTGG - Intronic
955532995 3:59893772-59893794 TTCCTCTGAGGCGGATCATGGGG - Intronic
956486601 3:69729451-69729473 GTCCTGTGAAGAGGCCCATGTGG - Intergenic
960865131 3:122192066-122192088 TCACTGTGAAGAACATCATTGGG - Intronic
961696348 3:128707939-128707961 GCCCTGTGGAGAGGTCCATGTGG + Intergenic
962269513 3:133967787-133967809 TGCCTGTGAAGGGAAGCATGTGG - Intronic
962609621 3:137063478-137063500 TACCTATGGAGAGGACCATGTGG - Intergenic
964045569 3:152321204-152321226 CCACTTTGAAGAGGATCATCAGG + Intronic
964372080 3:156010932-156010954 TTCCAGTGAAGAGGAAAATGTGG + Intergenic
965524764 3:169704104-169704126 TGCATGTGAAGGGGACCATGTGG - Intergenic
967430996 3:189384926-189384948 GCCTTGTGGGGAGGATCATGAGG - Intergenic
968803659 4:2758639-2758661 ACCCTGTGAAGAGGTCCATGTGG + Intergenic
969341150 4:6542293-6542315 TCTTTTTGAAGATGATCATGAGG - Intronic
970541541 4:17085519-17085541 GCCATGTAAAGAGGCTCATGTGG + Intergenic
971055302 4:22906515-22906537 TCTCTCAGAAGAGGATCATCAGG + Intergenic
972357361 4:38292727-38292749 GCCCTGTGGAGTGGGTCATGTGG + Intergenic
973863051 4:55084726-55084748 TCCCTTGGAAGAGTATCAGGAGG + Intronic
976422372 4:84860565-84860587 ACATGGTGAAGAGGATCATGGGG - Exonic
977317768 4:95472380-95472402 TCCCAGGTATGAGGATCATGAGG + Intronic
978451350 4:108837553-108837575 TCCCTGTTATGAGGTTCTTGTGG - Intronic
980555776 4:134402167-134402189 TGTCTGTGAAGATGATCATAGGG + Intergenic
980884689 4:138749377-138749399 TCCCTGTGGAGAGGCTTATGTGG - Intergenic
981162629 4:141516992-141517014 GCCCTGTGAAGAGGCTCATGTGG - Intergenic
982029013 4:151280298-151280320 TCCCTATGGAGAGGCCCATGTGG + Intronic
982422053 4:155209134-155209156 TTCCTATGAAGAGGGACATGAGG + Intronic
983386823 4:167074495-167074517 GCCCTGTGGAGAGGCCCATGTGG - Intronic
984124908 4:175795877-175795899 GCCCTGTGGAGAGGTTCATGTGG + Intronic
986974014 5:13374388-13374410 TTCCTGGCAAGAGGATCATTTGG + Intergenic
990969193 5:61484437-61484459 TCCCTGTGAAGAGGATAAGGAGG + Intronic
991339680 5:65594950-65594972 TCCATAGGTAGAGGATCATGAGG - Intronic
992446795 5:76841531-76841553 GCCCTGTGAAGAGGCCCACGTGG - Intergenic
994118559 5:96088767-96088789 TCTCGGGGAAAAGGATCATGGGG - Intergenic
994804355 5:104424648-104424670 TCCCTGAGCAGAGCATCCTGGGG + Intergenic
996741826 5:126806541-126806563 GCCCTATGAAGAAGACCATGAGG - Intronic
997365445 5:133322431-133322453 TCCCTGAGATGAGGATCTAGGGG + Intronic
997758344 5:136421443-136421465 TCCCTTTGAAGAGGGTCCTAAGG + Intergenic
998196831 5:140080761-140080783 GCCCTGTGGAGAGGTCCATGTGG + Intergenic
999351622 5:150876634-150876656 GCCCTGTGATGAGGGTCATTGGG + Intronic
1001170820 5:169417407-169417429 CATCTGTGAAGAGGATGATGTGG - Intergenic
1001942412 5:175750170-175750192 TCCCTGTCCAGAGGAACTTGGGG + Intergenic
1005857381 6:29872842-29872864 TCCCTGTGAAGATGAACCTCTGG - Intergenic
1006066270 6:31464567-31464589 TCCCTGTGAAGATGAACCTCTGG + Intergenic
1006150308 6:31983495-31983517 TCCCTGGGAAGAGGACTGTGGGG - Intronic
1006156609 6:32016233-32016255 TCCCTGGGAAGAGGACTGTGGGG - Intronic
1007066482 6:38996026-38996048 ACCCTGTGAAGAGGAGCCTCTGG - Intronic
1007843977 6:44738940-44738962 ACCCTGGGGAGAGGATCATGGGG + Intergenic
1009315331 6:62212071-62212093 TCCCTATGAATAAGAACATGTGG - Intronic
1011045182 6:83073824-83073846 GACCTGTGAAGAGGCCCATGTGG - Intronic
1012007622 6:93734345-93734367 GCCATGTGGAGAGGGTCATGTGG - Intergenic
1013468839 6:110442595-110442617 TCACTGTGGAGAGGATCATCTGG + Exonic
1014973135 6:127843824-127843846 ACCCTATGGAGAGGACCATGTGG + Intronic
1016957779 6:149643100-149643122 TGCCTGGGCAGAGGCTCATGTGG + Intronic
1022602569 7:31775730-31775752 TGCCTGTGAAGAGGAAAAAGAGG + Exonic
1023009179 7:35910054-35910076 GCCCTGTGGAGAGGTCCATGTGG - Intergenic
1023525131 7:41094135-41094157 TCCCTTTGATGATGATCATAGGG + Intergenic
1024434816 7:49339378-49339400 GCCATGTGAAGTGGCTCATGGGG - Intergenic
1024535348 7:50426462-50426484 GCCCTGTGGAGAGGCCCATGTGG - Intergenic
1024565189 7:50674647-50674669 TTTCTGTGCAGAGGATGATGTGG - Exonic
1026077017 7:67181126-67181148 TATCTATGAAGATGATCATGTGG + Intronic
1026699858 7:72631025-72631047 TATCTATGAAGATGATCATGTGG - Intronic
1027258235 7:76444907-76444929 TCCCTGTCAAGATGATCAACTGG + Intergenic
1027280613 7:76607112-76607134 TCCCTGTCAAGATGATCAACTGG - Intergenic
1027860422 7:83571471-83571493 CACCTGTGAAGATGATCATATGG - Intronic
1028105053 7:86867411-86867433 TCCCTGTGGAGAGGAGGATTTGG + Intergenic
1028215073 7:88121636-88121658 GCCCTGTGGAGAGGCCCATGTGG - Intronic
1028727502 7:94104340-94104362 GCCCTGTGGAGAGGCCCATGTGG + Intergenic
1028929535 7:96397599-96397621 TCACGGTGAAGAGCATCAAGAGG - Intergenic
1029434539 7:100555135-100555157 TCCCTCTGAAGAGAACCCTGTGG + Intronic
1029544486 7:101203015-101203037 CCCCTGGGAAGAGGATGGTGGGG + Intergenic
1031013940 7:116551930-116551952 GCCCTGTGGAGAGGCCCATGTGG - Intronic
1032162408 7:129520915-129520937 TCCCTGTGAAGAGGAAGAGGAGG - Intergenic
1033337979 7:140469609-140469631 TCCCTATGAAAAGGCCCATGTGG + Intronic
1035086970 7:156268586-156268608 TGCGTGTGAAATGGATCATGTGG + Intergenic
1036476318 8:9096535-9096557 TCACTGTGAGGATGATCAGGAGG + Intronic
1036507250 8:9366869-9366891 TCCCTGTTAAAAGGACCAAGTGG + Intergenic
1036593588 8:10192054-10192076 GCCCTATGAAGAGGCCCATGTGG - Intronic
1037235784 8:16717808-16717830 TCCCTCTGAAGATGATTTTGAGG - Intergenic
1037308258 8:17528495-17528517 TCCCTGTGGGGAGGCTCAAGTGG - Intronic
1038286174 8:26208123-26208145 TCCCTCTGGAGAGGCCCATGTGG - Intergenic
1042572869 8:70185588-70185610 TCTCTGTGGACAGGGTCATGGGG + Intronic
1042693170 8:71526626-71526648 TCCCTGTGGAGGGGCACATGTGG - Intronic
1044551893 8:93521759-93521781 ACCCTGTGAAGTGGATCATATGG + Intergenic
1049180830 8:141221365-141221387 TCCCTGTGAACAGGTTCCTCCGG + Intronic
1050114159 9:2245856-2245878 GCCCTATGGAGAGGACCATGTGG + Intergenic
1050375312 9:4966314-4966336 TCCCTCTGAAAATGATTATGTGG - Intergenic
1051333004 9:16042317-16042339 CCCTTATGAAGAGGATCATGAGG + Intronic
1052021348 9:23529312-23529334 GCCATGTGGAGAGGCTCATGTGG + Intergenic
1055082182 9:72278216-72278238 GCCCTGTGGAGAGGCTCATGTGG - Intergenic
1058327219 9:103713867-103713889 ACCCTATGGAGAGGCTCATGTGG + Intergenic
1059849834 9:118325542-118325564 TGCCTATGAAGAGGCCCATGTGG + Intergenic
1060017621 9:120100348-120100370 TCACTGGGAATGGGATCATGAGG - Intergenic
1060959822 9:127672355-127672377 GCCCTGTGGAGAGGCCCATGTGG - Intronic
1061042441 9:128148048-128148070 TTCCTGGGAACAGGGTCATGAGG + Intergenic
1062340085 9:136090260-136090282 TCCCTGGGAGGAGGAAGATGTGG + Intronic
1203744139 Un_GL000218v1:30451-30473 TCCATGTACAGAGTATCATGTGG - Intergenic
1186675687 X:11814941-11814963 GCCCTATGAAGAGGTCCATGTGG + Intergenic
1187013327 X:15302123-15302145 GCCCTGTGGAGAGGCTCATGTGG + Intronic
1187087944 X:16061274-16061296 TGCCTGTGGAGAGGGCCATGTGG - Intergenic
1189592909 X:42534453-42534475 GTCCTATGAAGAGGTTCATGTGG + Intergenic
1189950043 X:46219888-46219910 TCCCAATGAAGAGGACCAGGTGG + Intergenic
1190046040 X:47112270-47112292 TTCCTGTGAAGAGGATGATCAGG - Intergenic
1190377008 X:49797863-49797885 TCCATGTGAAGAGGATGATGAGG + Intergenic
1191666763 X:63710576-63710598 TGCCTGTTGAGATGATCATGTGG - Intronic
1194430721 X:93800774-93800796 TCCCTCTGAAGTGGTTCAAGTGG + Intergenic
1195098774 X:101532741-101532763 TCCCACTGAAGCTGATCATGAGG - Intronic
1198793596 X:140372254-140372276 TCCATGTGAAGAGCTTCATATGG + Intergenic