ID: 951399121

View in Genome Browser
Species Human (GRCh38)
Location 3:22208889-22208911
Sequence TCATGGAAGGCTTTGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951399117_951399121 5 Left 951399117 3:22208861-22208883 CCTTGATGCTGAAAAGGCTCCTA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 951399121 3:22208889-22208911 TCATGGAAGGCTTTGTAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951399121 Original CRISPR TCATGGAAGGCTTTGTAATG AGG Intronic
903791771 1:25898113-25898135 TCTTTGAAGGCTTTTGAATGTGG - Intronic
905283360 1:36863364-36863386 TCATGGAAGTATTTGAAGTGTGG - Intronic
906750983 1:48259667-48259689 TCAAAGAAGGCGTGGTAATGAGG - Intergenic
907592345 1:55687089-55687111 TCATGGAGGGCTTTGTAAGCAGG - Intergenic
907802611 1:57785540-57785562 TCATGGATGACTTTGAAAAGGGG + Intronic
908081765 1:60588364-60588386 TCATGAGAGGCTTTGTAATGTGG - Intergenic
909607176 1:77519257-77519279 CCATGATAGGCTCTGTAATGAGG + Intronic
909918787 1:81354597-81354619 TCAGGGTAGGCTTTATGATGTGG - Intronic
912403480 1:109416487-109416509 TCATGGAAGGCTTTGATGAGTGG - Intronic
915213821 1:154327587-154327609 TAATGGAAGCCCTAGTAATGGGG + Intronic
915230034 1:154438701-154438723 TCCTGGCTGGCTTTGTACTGTGG + Intronic
915508379 1:156371791-156371813 CCAGGGAAAGCTTTGTAATAAGG - Intronic
915951955 1:160195457-160195479 TCCTCGAAGGCTTTGTAATCTGG - Exonic
916457012 1:164981464-164981486 ACATGGCAGGCTTAGTGATGTGG + Intergenic
917164450 1:172096781-172096803 TCATGGAAGGATTTCCAATAGGG + Intronic
919059096 1:192608040-192608062 TCAGGGAAGGCATTCTAATTTGG + Intergenic
919782615 1:201230612-201230634 TCAAGGAGGGCTTCGTAAAGTGG + Intergenic
921602538 1:217121863-217121885 GCAAGGGAGGCTTTATAATGTGG - Intronic
921694362 1:218190640-218190662 GGATGGATGGCTTTGTAATTTGG + Intergenic
921708943 1:218353939-218353961 TCAAGGAAGGTTTTCTAAGGAGG - Intronic
921910586 1:220545072-220545094 TCAAGAAAGCCTTTGAAATGAGG + Intronic
922001128 1:221479677-221479699 TCAGGAAAGGCTTTAAAATGAGG + Intergenic
922015986 1:221647646-221647668 TAAAGGTAGGCTCTGTAATGAGG + Intergenic
1063614573 10:7590842-7590864 CCATGGAAGGCTTTGAAGAGAGG - Intronic
1065394197 10:25216728-25216750 TCATGGGAGGCTTTAGAAAGTGG + Intronic
1066049512 10:31620807-31620829 TCATGGAACCCTCTGGAATGTGG + Intergenic
1068977616 10:63027694-63027716 TCATGGACGTCTATGTGATGAGG - Intergenic
1070186782 10:74071398-74071420 TGAAGGAATGCTGTGTAATGTGG - Intronic
1072418917 10:95273143-95273165 TCCAGGAAGGTCTTGTAATGTGG - Intronic
1074657304 10:115606634-115606656 TCATGAATTGCTTTGTAATGGGG + Intronic
1074877272 10:117623151-117623173 TCAAGGAGTGCTTTGTAATGTGG - Intergenic
1075598807 10:123752141-123752163 GCATGAAAGGCTGTGTGATGTGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077459784 11:2703224-2703246 TTGTGGAAGGCTTTGAAATTTGG + Intronic
1077884339 11:6374999-6375021 TTATGGTGGGTTTTGTAATGTGG - Intergenic
1078004429 11:7521959-7521981 TCATGGAAGGCCTTGAAAGTTGG + Intronic
1079474990 11:20820789-20820811 TCAAGGAAGGCTCTCTAATAAGG - Intronic
1080268529 11:30425944-30425966 TCATGGCAGTCTTTTTATTGTGG + Intronic
1081402835 11:42662520-42662542 TCAAGAGAAGCTTTGTAATGTGG - Intergenic
1084468667 11:69342490-69342512 TGATGGGTGGCCTTGTAATGAGG + Intronic
1085203476 11:74716057-74716079 TCAGGGAAGGCTTTATAAGGAGG + Intronic
1086414449 11:86574892-86574914 ACATGGAAGGCTTTTTAAAGTGG - Intronic
1089577906 11:119459794-119459816 TCATGGCAGTCTTTGTGGTGCGG + Intergenic
1089869587 11:121660324-121660346 TAAGGGAAGGCTTCTTAATGGGG + Intergenic
1090801403 11:130174808-130174830 TCAGGGAAGAGTCTGTAATGTGG - Intronic
1091241589 11:134056092-134056114 CCATGGAAGGCTTTCTAACAGGG - Intergenic
1093515491 12:19981490-19981512 TAAAGGAAGGCTCTGAAATGGGG - Intergenic
1093588152 12:20867670-20867692 ACATGGAAGCTTCTGTAATGTGG + Intronic
1094294398 12:28888223-28888245 TCATGGAAAGATTTGTTCTGTGG - Intergenic
1094550945 12:31450734-31450756 TCATGAAAGGCCTTCTAAAGGGG - Intronic
1094757378 12:33488200-33488222 TCATGCATTGCTTAGTAATGAGG - Intergenic
1097338673 12:58413265-58413287 TCATGGAAAGCCTTCTAATTTGG - Intergenic
1098338016 12:69423410-69423432 TCCTGGAAGGCTTTCTGAGGAGG + Intergenic
1099975654 12:89543080-89543102 TCATGGAAGGTTTTGAAGTTAGG + Intergenic
1105561120 13:21491676-21491698 TCATGGAATGCTGTGGAAAGTGG + Intergenic
1106042661 13:26108579-26108601 TCATGGAAGCCTTTCTGAGGAGG - Intergenic
1106184448 13:27396746-27396768 TTATGGAGGACTTTGTATTGTGG - Intergenic
1106402174 13:29441491-29441513 TCATGGAGGCCTTGGCAATGAGG - Intronic
1106956823 13:34948356-34948378 TGCTGGAAGGCTTTCTGATGGGG + Intronic
1108380125 13:49847202-49847224 TCATGCAAGGCTCTGTGCTGTGG - Intergenic
1109448222 13:62473585-62473607 TAATGGAAGGTTTTGTTAAGGGG + Intergenic
1110307932 13:74011967-74011989 TCATACAAGGGTTTGAAATGTGG - Intronic
1112353213 13:98653934-98653956 TGATGGAGGGCTGTGGAATGGGG - Intergenic
1112353228 13:98653997-98654019 TGATGGAGGGCTGTGGAATGGGG - Intergenic
1112353243 13:98654060-98654082 TGATGGAGGGCTGTGGAATGGGG - Intergenic
1112353298 13:98654309-98654331 TGATGGAGGGCTGTGGAATGGGG - Intergenic
1112353313 13:98654372-98654394 TGATGGAGGGCTGTGGAATGGGG - Intergenic
1114680102 14:24477075-24477097 TCATGGAAGCAGCTGTAATGAGG - Intergenic
1116300418 14:43173823-43173845 TCATGAAAAGCTTTGCTATGTGG - Intergenic
1116860616 14:49992628-49992650 TGAGGGCAGGCTTTGTAATTGGG + Intronic
1118106725 14:62668270-62668292 TCTTGGAAGGCTTGAGAATGAGG + Intergenic
1119148389 14:72336468-72336490 TCATGGAAAGCTGTCTAATTTGG + Intronic
1121158056 14:91705684-91705706 TCATGGAAGGCTTCCCAAAGAGG - Intronic
1121984726 14:98493606-98493628 TCATGCAGGGTTTAGTAATGTGG + Intergenic
1123434694 15:20246662-20246684 CCAAGGAAGGCTTTGTGATATGG + Intergenic
1123502897 15:20907140-20907162 TGATGGGAGGCTTTGTATTATGG - Intergenic
1123560144 15:21480802-21480824 TGATGGGAGGCTTTGTATTATGG - Intergenic
1123596385 15:21918106-21918128 TGATGGGAGGCTTTGTATTATGG - Intergenic
1123680491 15:22759556-22759578 TCATGGAAGGCACTGTCATATGG - Intergenic
1123916105 15:25029006-25029028 GCATGGTAGACTTTGTAATCCGG + Intergenic
1124332709 15:28834013-28834035 TCATGGAAGGCACTGTCATATGG - Intergenic
1124455890 15:29842517-29842539 ACATGCACGGCTTTGCAATGTGG + Intronic
1124577361 15:30921694-30921716 TCATGGATGTCTTTGTAATATGG - Intronic
1124834149 15:33179485-33179507 CCAAGGAAGCCTTTCTAATGAGG - Intronic
1126373997 15:47976142-47976164 TCTTGGAAGGCTTTACAAAGTGG + Intergenic
1126376079 15:47997871-47997893 TCATGCAGAGCTTTGTACTGTGG + Intergenic
1128524993 15:68406290-68406312 TTATGGAGGGCCTTGCAATGAGG - Intronic
1129357127 15:74998677-74998699 TCTGGGAAGCCTTTGAAATGGGG - Intronic
1130332506 15:82933224-82933246 TCAAGGAAGGGTTCTTAATGTGG - Intronic
1202968492 15_KI270727v1_random:207966-207988 TGATGGGAGGCTTTGTATTATGG - Intergenic
1136849929 16:33604440-33604462 CCAAGGAAGGCTTTGTGATATGG - Intergenic
1138245829 16:55466648-55466670 TCCGGGAAGTCTATGTAATGTGG + Intronic
1139200841 16:64975318-64975340 TCATGGAAGGCTTTGAGCAGAGG + Intronic
1139357351 16:66374557-66374579 TCAGAGAACGCTTTGTTATGTGG + Intronic
1140066756 16:71617801-71617823 TCATGGCAGGGCTTGGAATGGGG - Intergenic
1140353967 16:74288370-74288392 TCAATGAAGGCTGTGGAATGGGG - Intergenic
1203111540 16_KI270728v1_random:1452893-1452915 CCAAGGAAGGCTTTGTGATATGG - Intergenic
1142585481 17:970150-970172 TCATGGAAAGTTTTGTTCTGTGG - Intronic
1142996764 17:3765006-3765028 TCATGGAGGACTTTATAAAGGGG + Intronic
1143351526 17:6291560-6291582 GAATGGATGGCTTTGTAAGGCGG - Intergenic
1144253484 17:13442631-13442653 TAATGGAAGCCTTTGTAATCTGG - Intergenic
1144423249 17:15116887-15116909 GCATGAAAGGCTTGGTGATGAGG + Intergenic
1146633764 17:34489190-34489212 TCAGGAAAGGCTTTCTAAAGGGG + Intergenic
1146789952 17:35745527-35745549 TCTTGGATGGCTTTGTCATAAGG + Exonic
1147054554 17:37824413-37824435 GCAAGGAAGGCTTTGAAAAGGGG - Intergenic
1150183167 17:63148714-63148736 TCAGAGAAGGCCTTTTAATGTGG + Intronic
1153665349 18:7363166-7363188 TCATGGTAGGATTTGAAATGAGG + Intergenic
1153668711 18:7390143-7390165 TCATGGAAAGCTTTGGAACGGGG + Intergenic
1153680108 18:7492417-7492439 TTATGGAAGGCTTTTGAAGGTGG - Intergenic
1153969747 18:10215491-10215513 CCATAGAAGGCTTTGTAAACAGG - Intergenic
1155012829 18:21798338-21798360 TCAAGTAAGGCTGTGTAATCTGG - Intronic
1155886463 18:31214801-31214823 GCATGGTTGGCTTTGAAATGTGG - Intergenic
1156455307 18:37289905-37289927 TCAGGGAAGTTTTTGAAATGTGG + Intronic
1157364426 18:47050788-47050810 TCAGGGAAAGCTTTGTAGAGAGG + Intronic
1157884732 18:51355711-51355733 TCATGGAAGGCTTTGGAACAAGG - Intergenic
1157899249 18:51498157-51498179 TTATTAAAGGCATTGTAATGAGG + Intergenic
1159081960 18:63745204-63745226 TCAGGAAAGGCTTTGTAGAGGGG + Intergenic
1159968921 18:74624975-74624997 TCATGTATGGCCTTGTATTGAGG + Intronic
1159974726 18:74696727-74696749 TGATGAGAGGCTTTGCAATGTGG + Intronic
1160460496 18:79035110-79035132 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460638 18:79035924-79035946 TCATGGAAGGCTCTGAGATATGG - Intergenic
1163373207 19:16914154-16914176 TCATGGGAGGCTCTGTACTCAGG + Intronic
1165677372 19:37738348-37738370 ACATTGAATGCTTTCTAATGTGG + Exonic
1167998848 19:53428441-53428463 TCATTGAAGGCCTGGTGATGTGG - Intronic
1168008969 19:53514551-53514573 TCATTGAAGGCCTAGTGATGTGG - Intergenic
926316462 2:11714084-11714106 CCATTGAAGGCTTTTTAATCAGG - Intronic
926928392 2:18011637-18011659 TCCTGGAAGGCAATGTAGTGTGG + Intronic
927016666 2:18970452-18970474 TCATTGAAGTCATTGTTATGTGG - Intergenic
927656229 2:24948921-24948943 TTATCGAAGGATTTCTAATGTGG + Intronic
930701290 2:54459399-54459421 TCCTGGAAGGGTTTGTAGAGTGG + Intronic
931546837 2:63397622-63397644 TCATAGAAGGCTGTTTGATGAGG + Intronic
931672209 2:64657633-64657655 ACATGGAAAGCTTTGCAAAGGGG - Intronic
932848921 2:75164744-75164766 TCCTGGAAGGCTCTGTCATTTGG + Intronic
933917070 2:87006311-87006333 TCATGTAAGCCTTTGAAATCTGG - Intronic
934005925 2:87763603-87763625 TCATGTAAGCCTTTGAAATCTGG + Intronic
935768879 2:106397703-106397725 TCATGTAAGCCTTTGAAATCTGG + Intronic
935878028 2:107533782-107533804 TCCTAGAAGGCATTTTAATGGGG - Intergenic
935911223 2:107898221-107898243 TCATGTAAGCCTTTGAAATCTGG - Intergenic
935969331 2:108515058-108515080 TCATGTAAGCCTTTGAAATCTGG - Intergenic
936132994 2:109863263-109863285 TCATGTAAGCCTTTGAAATCTGG - Intergenic
936211703 2:110508222-110508244 TCATGTAAGCCTTTGAAATCTGG + Intergenic
936420842 2:112362799-112362821 TCATGTAAGCCTTTGAAATCTGG + Intergenic
937429926 2:121829737-121829759 TCATGGAAAGCTTTCTGGTGTGG + Intergenic
939137790 2:138316925-138316947 TTATGTAAGGTTTTGTATTGGGG - Intergenic
939363026 2:141198348-141198370 TAAGGAAAGGCTCTGTAATGTGG - Intronic
939497245 2:142938692-142938714 TCATGAAAAGTTTTGTAATTTGG - Intronic
940332724 2:152492549-152492571 TTATCTAAGGCTTTGTAAGGGGG + Intronic
941397655 2:164993082-164993104 GCCTGGAGGGCTTTGTGATGTGG + Intergenic
942802496 2:179891789-179891811 TCCTGGAGGGCTTTGGAATGTGG - Intergenic
944080000 2:195776876-195776898 TCATGGATGGCTTTATGATTTGG + Intronic
945274780 2:207977298-207977320 CCATGGGAGGCTTTGGACTGGGG - Exonic
947471714 2:230406931-230406953 TGATTCTAGGCTTTGTAATGTGG + Intergenic
948633248 2:239315827-239315849 TCAAGGAAGGCTTTCTAACCAGG + Intronic
1171282349 20:23911356-23911378 CCATGGAGAGCTCTGTAATGGGG - Intergenic
1171289662 20:23975052-23975074 TCATTGTGGGCTTTGTCATGTGG - Intergenic
1173120927 20:40288195-40288217 TCATGGAAGGGTCTGTCCTGGGG - Intergenic
1173312864 20:41916215-41916237 TCATAGCTGGCTCTGTAATGGGG + Intergenic
1173713683 20:45182176-45182198 GGATGGAAGGCTGTGTAATCAGG - Intergenic
1175228427 20:57458935-57458957 TGAGGGAAGGCTTTGGAAAGGGG - Intergenic
1176081918 20:63277786-63277808 TGACGGAAGGCTTTGCACTGCGG + Intronic
1178128618 21:29544418-29544440 TCATGGAAAACTTTGAAAAGTGG + Intronic
1178194539 21:30328789-30328811 TCATGGAGGGCTATGTTATATGG - Intergenic
1178869970 21:36365233-36365255 TCAGCGAAGGCTTTGTGATGAGG + Intronic
1179398552 21:41062981-41063003 CCATGAAAGGCTTTGAAAAGTGG - Intergenic
950790394 3:15466982-15467004 TCAGGGAAGGCTTTGCCATAGGG - Intronic
950850023 3:16053375-16053397 TGGTGGAAGACTTTGTGATGAGG - Intergenic
951399121 3:22208889-22208911 TCATGGAAGGCTTTGTAATGAGG + Intronic
952032180 3:29156538-29156560 TCATGGAAAGCTCTGAAGTGAGG - Intergenic
953043400 3:39274540-39274562 TAATGGCAGGTTTTGTAAAGGGG - Intronic
954758031 3:52852861-52852883 TTATTGAAGGCTTTGAAAGGTGG - Intronic
955835467 3:63049620-63049642 TCATGGACTGCTTTAAAATGAGG + Intergenic
956771675 3:72531964-72531986 GAATGTAAGGCTTTGTAATCTGG - Intergenic
958660387 3:97059507-97059529 TCATCAAAGGTATTGTAATGTGG + Intronic
959652637 3:108766416-108766438 TCAGGGGAGGGTTTGTAAAGTGG + Intergenic
961102499 3:124212552-124212574 TCATGCAATACTTTTTAATGTGG - Intronic
961338964 3:126204529-126204551 TAATGAAATGCTTTTTAATGAGG + Intergenic
963002024 3:140690791-140690813 TCTTGGAAGACTGTGTGATGAGG - Intronic
963350759 3:144148367-144148389 CCATGGAAGGATTTTGAATGGGG + Intergenic
966155693 3:176913913-176913935 TCATGGAAGGCTTTGTGGGGAGG - Intergenic
966492501 3:180543571-180543593 TCATGGAAGGGTTGAAAATGTGG - Intergenic
969502358 4:7560789-7560811 TCTTGTAAGGCTGGGTAATGAGG + Intronic
971160180 4:24125968-24125990 TCCTGGCGGGCTTTGAAATGAGG + Intergenic
971198242 4:24489354-24489376 TCATAGAAGTATTTGAAATGTGG + Intergenic
971906177 4:32728748-32728770 TAATGTAGGGCTTTGTCATGAGG - Intergenic
972228841 4:37046466-37046488 TCTGGGAAGGATTTCTAATGAGG + Intergenic
975956932 4:79852374-79852396 TGATGCAAGGCTGTGAAATGGGG + Intergenic
975983072 4:80180916-80180938 GCATAGAAGGTTTTGAAATGTGG - Intergenic
979598451 4:122559679-122559701 GCATGGAAGGCTGAGAAATGTGG - Intergenic
980403869 4:132331091-132331113 TTATGGAAGGCTTAGTAAAGGGG - Intergenic
982094779 4:151911947-151911969 TAATGGATTTCTTTGTAATGCGG + Intergenic
982517889 4:156374836-156374858 TCATGGAATGGTTTACAATGTGG + Intergenic
984607093 4:181797767-181797789 CCATGCATGGCTTTCTAATGTGG + Intergenic
985429544 4:189865889-189865911 TCCTAGTAGGCTTTGTAATTAGG - Intergenic
985928969 5:3040951-3040973 CCTTGGAAGGGTTTGTATTGAGG + Intergenic
986391489 5:7291525-7291547 TCATGGAAGGCACTGTCATATGG - Intergenic
987165403 5:15193084-15193106 TCATGCAATGCTTTGAGATGGGG + Intergenic
989256937 5:39376356-39376378 TCTTGGAGGGCTGTGTAATAAGG - Intronic
990988324 5:61661408-61661430 TCAGGGATGGCTTTGTAGGGTGG + Intronic
991399023 5:66234539-66234561 TCATGGAAGGCTTTGTGCTTGGG + Intergenic
991603248 5:68374442-68374464 TCATAGAAGGATTTGCAGTGGGG - Intergenic
991650402 5:68846973-68846995 TCAGGAAAAGCTTTCTAATGTGG + Intergenic
992084522 5:73265929-73265951 TTATGGAATGGTTTATAATGAGG + Intergenic
992203148 5:74403702-74403724 ACATGGAAGACTTTTGAATGTGG + Intergenic
996141549 5:119915406-119915428 TCATGGTTGGCTGTGGAATGTGG - Intergenic
997921047 5:137979729-137979751 TTATGGAAGGTCTTGGAATGAGG - Intronic
998811474 5:145971007-145971029 ATTTGGAAGGCTTTGGAATGAGG - Intronic
999537132 5:152529567-152529589 TCAGGGAAGACTTGCTAATGAGG + Intergenic
999620135 5:153464511-153464533 TCATGGAAAGCCTTCTAATTCGG - Intergenic
1000522066 5:162307540-162307562 TCAGAGAATTCTTTGTAATGAGG + Intergenic
1000777015 5:165432594-165432616 TCAGTGAAGGTTTTTTAATGCGG + Intergenic
1001836201 5:174834903-174834925 TCATTGAAGGATTTGGAATAAGG - Intergenic
1002206977 5:177569557-177569579 TGAGGGAAGGCTTTGAAATGGGG - Intergenic
1007002512 6:38327665-38327687 TGATGGAAAGCTTTGTTATCTGG - Intronic
1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG + Intergenic
1009262645 6:61514127-61514149 TGACAAAAGGCTTTGTAATGTGG + Intergenic
1013818945 6:114133010-114133032 CCATGGAAGGGTTTGGAGTGGGG - Intronic
1014819387 6:125970014-125970036 TCTGGAAAGGCTTTGTCATGAGG + Intronic
1015108754 6:129568153-129568175 TCATGGAGGGCTTTGTGTTAGGG - Intergenic
1015705525 6:136083589-136083611 TCAGGGGAGGCTTTCAAATGTGG - Intronic
1017225416 6:152015537-152015559 TCATGGAAGACTTCGTAAACTGG - Intronic
1022240867 7:28511423-28511445 TCCTGGGAGGCCTTGTAAAGGGG + Intronic
1022477861 7:30723525-30723547 CCATGGAAGGCTTTATGGTGGGG + Intronic
1022501061 7:30882661-30882683 CCATGGAAGGTTTTGGAATCAGG + Intronic
1023149566 7:37188836-37188858 TCATGGAAGGCTCAGTCATGGGG - Intronic
1023534670 7:41195736-41195758 ACATGGAAAACTTTGTAAAGAGG - Intergenic
1024324265 7:48096404-48096426 TCATGGAAGGCTTTCGACTTGGG - Intronic
1024837941 7:53546024-53546046 TAATGGAAGACTTTGACATGTGG + Intergenic
1026688286 7:72531429-72531451 TAATGGAAGGCAGTGCAATGAGG - Intergenic
1028012886 7:85671531-85671553 TCAGGACAAGCTTTGTAATGTGG + Intergenic
1028751531 7:94389018-94389040 TAGTGGAAGGCTTTAAAATGGGG + Intergenic
1030799214 7:113828667-113828689 TTAGGGAAGGATTTTTAATGAGG + Intergenic
1032538234 7:132682586-132682608 TCATTGATGGCTTTATGATGAGG - Intronic
1036017709 8:4804392-4804414 GCATAGAAAGCTTTGTAATTTGG - Intronic
1036989420 8:13575848-13575870 TAAAGGAAGGCTTTGTATTGTGG + Intergenic
1038444813 8:27595934-27595956 TCTGGGAAGTCTTTGTAATGTGG + Intergenic
1038653097 8:29423510-29423532 TCTTTGGGGGCTTTGTAATGAGG - Intergenic
1038961794 8:32528131-32528153 TCAAGGAAGGCTTTCCAAAGAGG - Intronic
1040537898 8:48325543-48325565 TCATTTAAGGGTTTTTAATGGGG + Intergenic
1041373247 8:57186723-57186745 TTATGGTAAGTTTTGTAATGCGG - Intergenic
1044282217 8:90369290-90369312 TCATGGGAGGCTTGGAAATAAGG - Intergenic
1045128110 8:99116873-99116895 TCATTGAAGGATATGTAATGTGG + Intronic
1045913168 8:107434376-107434398 TCATGGAAGGTTTTTAAGTGGGG + Intronic
1047675536 8:127197474-127197496 TGATGGAAGGCTTCCTAAAGAGG - Intergenic
1047860367 8:128959344-128959366 TCAGGGAAGACTTAGAAATGAGG + Intergenic
1048838424 8:138543722-138543744 TCTTGGAAGGGTTTGGAGTGTGG - Intergenic
1050015680 9:1231297-1231319 TCATAGCAGGATTTGAAATGTGG + Intergenic
1052751420 9:32495513-32495535 TTATAGAAGCCATTGTAATGGGG + Intronic
1056480811 9:87003842-87003864 TCAAGAAAGTCTTTGTGATGTGG - Intergenic
1057111921 9:92480186-92480208 TCATGGAAAGCTTTGGATTTTGG + Intronic
1057415043 9:94854324-94854346 TCATGAAAGATTTTGGAATGTGG + Intronic
1057800437 9:98187843-98187865 CCATGGAAGGCTTTTGAATTGGG - Intronic
1057864849 9:98671735-98671757 TCAAGGAAGGCTTTTAAATGGGG + Intronic
1059260923 9:112975929-112975951 TCATGGAAGGCTCTTCAAGGAGG - Intergenic
1059414088 9:114152692-114152714 TCATGCACGCATTTGTAATGTGG - Intergenic
1059523419 9:114965648-114965670 TCATGGAAGTCTTAGGTATGTGG + Intergenic
1059558178 9:115303006-115303028 TCATGGTGTGCTTCGTAATGGGG + Intronic
1060146712 9:121259398-121259420 ACAGGGAAGGCTTTGCAAGGAGG + Intronic
1186171481 X:6881908-6881930 TTCTGGAAGACTATGTAATGGGG + Intergenic
1189682905 X:43535283-43535305 TCAGTGGAGGCTTTGTCATGTGG - Intergenic
1190939050 X:55023499-55023521 TTATGGAAGTGTTTCTAATGAGG - Intronic
1192397863 X:70801460-70801482 TCCTGGAAGGCAGTGTCATGTGG - Intronic
1193285681 X:79712531-79712553 TCATGGATGGCTTTTTATTTGGG - Intergenic
1194534561 X:95089888-95089910 TCCTGGAAGGCTTTTTATTACGG - Intergenic
1195895937 X:109746259-109746281 TCAGGAGAGGCTTTGGAATGAGG - Intergenic
1197063902 X:122216093-122216115 TCTTGAAAGGCTTTGGGATGGGG + Intergenic
1197128766 X:122979384-122979406 TCATGGAAGGTTTTGGAGTCAGG + Intergenic
1200414054 Y:2889746-2889768 TCATGGAAGGCTTCATAAGGAGG - Intronic
1201715395 Y:17039104-17039126 ACTTGGAAGGCTTAGGAATGAGG - Intergenic