ID: 951402292

View in Genome Browser
Species Human (GRCh38)
Location 3:22248294-22248316
Sequence TCAAGCTTGAATAAAATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951402292 Original CRISPR TCAAGCTTGAATAAAATTTA AGG (reversed) Intronic
902678016 1:18022488-18022510 TTAAGCTGGAATAAAAATAACGG + Intergenic
904977605 1:34470113-34470135 TAAAGCATGACTAGAATTTAGGG + Intergenic
907080734 1:51619180-51619202 TCTATCTTGAATAGAGTTTACGG - Intronic
908856144 1:68431840-68431862 CCATCCTTGAAGAAAATTTAGGG + Intronic
910134668 1:83953485-83953507 TCAATATTAAAGAAAATTTAGGG + Intronic
910160761 1:84270024-84270046 TAAAGTTTGAATAAAGTCTAGGG + Intergenic
910304565 1:85748106-85748128 TCAAGCAAAAATAAAAATTAGGG - Intronic
910670686 1:89769713-89769735 TCAACATTAAATAAAATTCAAGG + Intronic
911971378 1:104441909-104441931 TTAAACTTCAATAAAATTTATGG + Intergenic
915161913 1:153926629-153926651 TCAATTTTTAAAAAAATTTATGG + Intergenic
917141983 1:171843828-171843850 TCAAGATGGAATAAAAAATAGGG + Intronic
918233638 1:182558235-182558257 TCTAGTTTGAATAAAAAATATGG + Intronic
918835383 1:189456629-189456651 TCAAGCATCAATAGCATTTAGGG + Intergenic
918848789 1:189655586-189655608 TGAAACTTTAATAAAATGTATGG + Intergenic
919280038 1:195478007-195478029 TCAATCTAGAATATAATTTCAGG - Intergenic
923199543 1:231698034-231698056 TCATGCCTGAATAAAGTTTCTGG - Intronic
923487003 1:234442981-234443003 TCAAGCCAGAATAAAAATTATGG + Intronic
923795165 1:237146958-237146980 TAAAGCTGGTATAAAATTAAGGG - Intronic
924053825 1:240104876-240104898 TCATGTTTAAATAAAATCTAGGG - Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1065576692 10:27127838-27127860 TTAAACTTCAATGAAATTTATGG + Intronic
1065598411 10:27341483-27341505 TTGGGCTTGAATAAACTTTACGG + Intergenic
1066075108 10:31867405-31867427 TCAAGCTTGAGGAAAATTGTTGG - Intronic
1067841828 10:49687266-49687288 TCCTGCTTTAATAAAATTTTTGG - Intronic
1068378531 10:56215816-56215838 TCAAGGTGGAATATAATTTTAGG - Intergenic
1071180518 10:82978405-82978427 TCAAGATTGATTAAAATCTGAGG + Intronic
1072491635 10:95911932-95911954 TGAAGGTTGAATAAGATGTAAGG + Intronic
1072604486 10:96968338-96968360 TCAAGCTAGAATTAGAATTAGGG + Intronic
1073385191 10:103121299-103121321 TCCAGCATTAAAAAAATTTATGG - Intronic
1073561718 10:104502686-104502708 TCAATATTGAATACAATTTAGGG + Intergenic
1073750107 10:106515650-106515672 TCAGGCTTAAAAAAAATGTATGG + Intergenic
1073785506 10:106884938-106884960 TCAAGCTTCAGTAAAAGTTTAGG - Intronic
1074164668 10:110864541-110864563 TAAAACTTGCATAAAATTTTAGG + Intergenic
1074409494 10:113213468-113213490 ACAAGTTTCAATAAAATTAAAGG - Intergenic
1075562428 10:123478006-123478028 TCATGCTAGATTAAAATTTCTGG + Intergenic
1077509776 11:2952163-2952185 TCAGCCTTGTAGAAAATTTAAGG - Intronic
1077668180 11:4134365-4134387 TCAAGCTTAATTAAAAATCATGG + Intronic
1079720823 11:23811695-23811717 TGAATAGTGAATAAAATTTATGG - Intergenic
1083124127 11:60545846-60545868 ACAAGCATCAATAACATTTAGGG + Intergenic
1084584314 11:70048328-70048350 TTAAGGTTGAATAAAGTTTAAGG + Intergenic
1085992875 11:81871841-81871863 TCAATTGTGTATAAAATTTATGG - Intergenic
1086158807 11:83697736-83697758 AAAAGCTTTAATAAAATTAAAGG + Intronic
1087453198 11:98351413-98351435 ACATGATTGAATAATATTTACGG + Intergenic
1088942029 11:114468933-114468955 ACTAGCCTAAATAAAATTTAAGG + Intergenic
1089783699 11:120892849-120892871 CCAAGCTTGAAAGAATTTTAAGG - Intronic
1090708296 11:129360521-129360543 TCAAGCTTTATTAATATTTAAGG - Intergenic
1090903597 11:131054024-131054046 TCAAGGTTCAATAAAACTAATGG + Intergenic
1091098649 11:132848573-132848595 TCTAGCTTTAACAAAAATTATGG - Intronic
1091472116 12:738056-738078 GCAAACTGGAATAAAATATATGG - Intergenic
1092889812 12:12958751-12958773 TGAGGCTAAAATAAAATTTAAGG - Intergenic
1093317594 12:17669666-17669688 TCAATCTTGAGGAACATTTAAGG + Intergenic
1093518385 12:20018501-20018523 CCAAAGTTGAAAAAAATTTATGG + Intergenic
1094148667 12:27257810-27257832 TTAAGATTGTATAAATTTTAGGG + Intronic
1094226068 12:28047710-28047732 TCAAGGCTGAATACAATTGAGGG - Intergenic
1095159663 12:38902033-38902055 TGAAGCTTGAATATAATTCATGG - Intronic
1095464274 12:42474290-42474312 TAAAACTTGATTAAAATTTATGG + Intronic
1095535294 12:43238914-43238936 TCATTATTGAATTAAATTTAAGG - Intergenic
1097522446 12:60686290-60686312 TCAAACAAAAATAAAATTTATGG + Intergenic
1098205411 12:68104141-68104163 TCAAGCTAAAATAATATGTATGG + Intergenic
1098375829 12:69812891-69812913 GCAAGCTTTATTAAAATTCATGG - Intronic
1098500346 12:71185060-71185082 TAAAGCTGAAATAAAATCTAAGG - Intronic
1098543377 12:71684597-71684619 TTAAGCTAGAATAACTTTTATGG + Intronic
1099116106 12:78626438-78626460 TTAAGCCTCATTAAAATTTAAGG + Intergenic
1100399670 12:94217901-94217923 GCAAGCTTGATGAACATTTATGG + Intronic
1100654673 12:96628839-96628861 CAAAACTTGAATAAAATGTAGGG - Intronic
1103422792 12:120802039-120802061 TCTAGCCTGAAACAAATTTAGGG - Intronic
1103690544 12:122770195-122770217 TCAGCCTTGCATAAAACTTATGG + Exonic
1104297725 12:127532687-127532709 TAAAGCTGGAAAAAAATTCATGG - Intergenic
1106829922 13:33569494-33569516 TCAATCTTTAAGAAATTTTAAGG + Intergenic
1108949587 13:56074120-56074142 TCAAGCTGAACTAAAATATAGGG + Intergenic
1109443341 13:62401987-62402009 TCATTCTTGTATAAAAGTTATGG + Intergenic
1109659576 13:65440351-65440373 TCCATCTTGAATTAATTTTAGGG - Intergenic
1109779021 13:67083023-67083045 TGAAGCTAAAATAAAATTAATGG + Intronic
1109869819 13:68320166-68320188 TCTATTTTGAAAAAAATTTAAGG + Intergenic
1110010748 13:70330728-70330750 TGAAGAATGAATAAACTTTAAGG - Intergenic
1110306693 13:73996124-73996146 TAAAACTGGAATAAAATTAAAGG - Intronic
1110645451 13:77878097-77878119 TCAGGCTTAAATCAACTTTAAGG - Intergenic
1112645414 13:101326111-101326133 TTAAGCTAGACAAAAATTTAAGG + Intronic
1113071000 13:106421258-106421280 CCAAGCTTCTATAAAATCTAAGG - Intergenic
1113242742 13:108357275-108357297 TAAAACTTAAATAATATTTAAGG + Intergenic
1116089204 14:40283293-40283315 TCAAGCTTGAAAATAATGAAGGG - Intergenic
1116566568 14:46452063-46452085 TCAACCTTCAATAAAAATTATGG + Intergenic
1117054783 14:51900821-51900843 TCATGATTGAATAAAAGTAATGG + Intronic
1118232234 14:63963722-63963744 TCAATCTGGTTTAAAATTTAAGG + Intronic
1119935618 14:78589846-78589868 TGAAACTTAAATCAAATTTAAGG - Intronic
1120469608 14:84905390-84905412 TCATGGTTGTAGAAAATTTAAGG + Intergenic
1123489428 15:20769292-20769314 TTTAGTTTAAATAAAATTTAAGG + Intergenic
1123545927 15:21338379-21338401 TTTAGTTTAAATAAAATTTAAGG + Intergenic
1123901376 15:24880542-24880564 TAAAACTTGGATAAAATGTATGG - Intronic
1124788985 15:32708909-32708931 TAAAGCTTAAATACCATTTAAGG + Intergenic
1125110660 15:36028622-36028644 CAAAGCTTGGCTAAAATTTATGG + Intergenic
1125126579 15:36230391-36230413 TCAATCTTTAATTACATTTATGG - Intergenic
1126131323 15:45344418-45344440 CTAAGCTTGAATAAGCTTTAGGG + Intergenic
1127243229 15:57141922-57141944 TCAAGCTTGAATGACATAAAGGG + Intronic
1131080481 15:89530493-89530515 TGAGGCTTGAATAAGATTAAAGG - Intergenic
1131911250 15:97205813-97205835 GCAAGTTTGTATGAAATTTATGG + Intergenic
1202954270 15_KI270727v1_random:65651-65673 TTTAGTTTAAATAAAATTTAAGG + Intergenic
1133721800 16:8501398-8501420 TCAGGCTTTAGAAAAATTTAAGG + Intergenic
1135690968 16:24537555-24537577 TCAAGGTTGAACAAAGTTTTTGG + Intergenic
1137911560 16:52383190-52383212 TCAGGCTTGGAAAAAATTGATGG - Intergenic
1138756195 16:59488661-59488683 ACAATCTTGAAGAAAACTTATGG + Intergenic
1140329610 16:74041642-74041664 GAAAGCCTAAATAAAATTTAAGG + Intergenic
1143238217 17:5421074-5421096 GCAAGCTAGAATAAAAAATATGG + Intronic
1146113017 17:30108822-30108844 TCCAGTTTTAATAAAATTTTGGG + Intergenic
1146295526 17:31647125-31647147 TCAAGCTTAAATAAAGTCTGAGG + Intergenic
1146429845 17:32782114-32782136 TCCAGCTTAAAGGAAATTTAAGG - Intronic
1149025374 17:52021115-52021137 TAAAAGTTGAATAAAAGTTATGG + Intronic
1149149688 17:53546007-53546029 TCAAGAATAAATAAAATTTCAGG - Intergenic
1153129786 18:1841637-1841659 TTAAGCTTGAATAGAAATTAGGG - Intergenic
1153910573 18:9702995-9703017 ATAATCTTAAATAAAATTTATGG + Intergenic
1154059178 18:11042865-11042887 TCCAAGTTGAATTAAATTTATGG + Intronic
1155695153 18:28676469-28676491 CCAAGCTTGAAAAAAAGTTAAGG + Intergenic
1156815997 18:41312023-41312045 TCAGGCTTGAATAAAAGTGTTGG - Intergenic
1157101909 18:44738459-44738481 TCAAGCTGCAAATAAATTTATGG - Intronic
1158368931 18:56774862-56774884 TCATCCTTTAATAAATTTTATGG - Intronic
1158683029 18:59585750-59585772 ACAAGCTTGATGAAAATGTATGG - Intronic
1159313284 18:66737818-66737840 TAAAGCTTGAAAATATTTTAAGG + Intergenic
1159474901 18:68908727-68908749 TCAAACTTAAATAATATTAATGG + Intronic
1164155419 19:22593560-22593582 TGAAGGTTGAATATAATTCAGGG - Intergenic
926619673 2:15036216-15036238 GCAAGCATGAATAAGATTCAAGG - Intergenic
927549386 2:23984078-23984100 TAAAACTTGAAAATAATTTAAGG - Intronic
930188773 2:48436642-48436664 TCCAGTTTGAAAAAAATTCAGGG - Intergenic
931056179 2:58473999-58474021 TCAAGCTGGAATCAAGGTTAAGG + Intergenic
931581362 2:63778828-63778850 TAAAGCTTGAACAAAAATTTCGG - Intronic
932089561 2:68793370-68793392 TAAAGCTAGAATAAAATCAAGGG - Intronic
933601187 2:84332161-84332183 TCATGCTTAAATAATATTTTTGG - Intergenic
933822736 2:86129156-86129178 CCAAGGTTGAGTAAAATTTTAGG - Intronic
933985393 2:87586989-87587011 TCAAGATTGCATTGAATTTATGG + Intergenic
934904965 2:98192076-98192098 TGAAGCTTCAATGAAACTTATGG - Intronic
934956689 2:98627999-98628021 TAAAGCTTGAAAAAAATGTAAGG - Intronic
935072287 2:99705478-99705500 TCAAGCTAGAAATAAGTTTAAGG + Intronic
936308448 2:111363820-111363842 TCAAGATTGAATTGAATTTATGG - Intergenic
936473586 2:112820159-112820181 TAAAGCATGAAGAAAATTTAGGG - Intergenic
939764544 2:146229964-146229986 TAATGCTTGAATAAACTTCAAGG - Intergenic
940953301 2:159701498-159701520 TCAAACTTTAAAAAAATTCAGGG + Intergenic
942164460 2:173228527-173228549 TAAAGAATGAATAAAATTAAAGG - Intronic
942198756 2:173549924-173549946 TTAAGATTGAATAAAATGTATGG + Intergenic
942555182 2:177165511-177165533 TCTGGCTAGAATAAAATCTAAGG + Intergenic
942910373 2:181236345-181236367 ATAAGCTTGAAGAAAATTGAAGG + Intergenic
943175591 2:184469042-184469064 GATAGCTTGAATAAACTTTAAGG - Intergenic
943409326 2:187526635-187526657 TGAATCTAGAAAAAAATTTATGG + Intronic
943958679 2:194229986-194230008 TCTACCTTAAATAAAAATTAAGG - Intergenic
945831342 2:214790108-214790130 ACTAGCTAGAATAAAATTTCTGG + Intronic
1170629559 20:18056057-18056079 CCAATCTTGAATTAAATTGATGG - Intronic
1171211721 20:23321987-23322009 GCAGGCTGGAAGAAAATTTAAGG - Intergenic
1171314522 20:24177466-24177488 TCAAGCTCGACGCAAATTTAGGG - Intergenic
1173775288 20:45701163-45701185 TCAAGCTTCAATGAAATTGATGG + Intronic
1174348076 20:49946297-49946319 TCAAGCTTGGAGAAAAATGACGG + Intronic
1174804783 20:53594829-53594851 TCAAGCTTGAAGAAAATCTTTGG - Intronic
1176698507 21:10011513-10011535 TCAAGTTTGAATCAAATATTAGG + Intergenic
1177655968 21:24018131-24018153 TCAAGCTTTAATAATAGTTTTGG + Intergenic
1178611708 21:34087934-34087956 TCAAGGATGACTAAAATTTTTGG + Intronic
1183535755 22:38399373-38399395 TCACGCTTGAAGAAAATCTGAGG - Intergenic
1184427458 22:44420798-44420820 TGAAGTTTGAATAATTTTTATGG + Intergenic
951216593 3:20031089-20031111 TCAGGCTTTAATAAAAGTAAGGG + Intergenic
951402292 3:22248294-22248316 TCAAGCTTGAATAAAATTTAAGG - Intronic
951716735 3:25656892-25656914 TTAAGCTAGAATAAAACTGAAGG + Intronic
952046174 3:29323811-29323833 ACAAGCTTAAATAAAAATCATGG - Intronic
955064201 3:55520622-55520644 TCAAGCTTGATAAAAAGATACGG + Intronic
956019834 3:64922367-64922389 TCAAGCTTGAAAAAGAGTTAAGG - Intergenic
956695401 3:71914771-71914793 CCAACCTTGAATATATTTTAAGG + Intergenic
957492070 3:80940801-80940823 TCAAGCTTGAGTGTAATTTGTGG - Intergenic
957849342 3:85786174-85786196 TTAAACTTCAATAAAAATTAAGG - Intronic
959181133 3:102981821-102981843 TGAATGTGGAATAAAATTTATGG - Intergenic
960023372 3:112980888-112980910 TAAAATTTGAATAAAATTTCAGG - Intergenic
960364847 3:116758677-116758699 ACTAACTAGAATAAAATTTATGG + Intronic
960382094 3:116975439-116975461 TCAAGTTTTACTAAAATTTCAGG + Intronic
960662799 3:120079274-120079296 TCAAGGTTGTAGAAAATTAAAGG - Intronic
962260896 3:133904976-133904998 GCAAGCCTGAATAAATTTAAGGG - Intergenic
962716683 3:138132698-138132720 TTTAGCTTGAATCAAAATTATGG + Intergenic
963304298 3:143633468-143633490 TGGAGCTTTAAAAAAATTTATGG - Intronic
963722743 3:148881966-148881988 TCAATTTTGAATAGAATTTGAGG + Intronic
963822915 3:149919130-149919152 TTAAACTTTAAAAAAATTTATGG + Intronic
964439124 3:156687235-156687257 CTAAACTTGAATAAAAGTTAAGG + Intronic
965207994 3:165746409-165746431 TCAAGATAGATTAAAAGTTAAGG + Intergenic
966557529 3:181280183-181280205 TTAAGGGTGAATAAAATTAATGG + Intergenic
966598299 3:181748013-181748035 TCAAATTAGAATAAAATTTGAGG + Intergenic
967139028 3:186537827-186537849 TCAAGATTAAATAAAATCTCAGG + Intergenic
967158553 3:186715386-186715408 TCAACCTTGAATGAATTTAAAGG + Intergenic
967517170 3:190383633-190383655 TGACCCTTGAATAAAATATAGGG - Intronic
970219189 4:13792330-13792352 TCAAATTTGAATAAAATTTCAGG + Intergenic
970262263 4:14239515-14239537 GCAAGCTGGAAAAAAATATATGG + Intergenic
971397384 4:26241380-26241402 TCAAGCATGAAGAAAATTCCAGG + Intronic
971779373 4:31011997-31012019 TGATGCCTGAATAAAATATAGGG - Intronic
972100974 4:35416556-35416578 TCATTCTTAAATGAAATTTATGG + Intergenic
975510752 4:75192023-75192045 TCAATCTTGTATATAATTTTGGG - Intergenic
976536162 4:86220505-86220527 TCAGGACTAAATAAAATTTAAGG - Intronic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
977240166 4:94558644-94558666 TCATACTTGAATATAATTCAAGG - Intronic
977717525 4:100198386-100198408 TCAAGGTTGAATATAATTCAGGG - Intergenic
978083903 4:104626277-104626299 TGAAGCTCGAATAAAATTTCTGG + Intergenic
978250885 4:106630310-106630332 TGAAGCCTGAATATACTTTAGGG - Intergenic
978871068 4:113578633-113578655 ACAAACTTGAGTAAAATTTCTGG - Intronic
979317611 4:119283220-119283242 TCTGTCTTGAATATAATTTAAGG - Intronic
979393469 4:120156342-120156364 TCCAGTTTGAAGAAAATGTAAGG + Intergenic
979743849 4:124184519-124184541 TAAAGATTGAAAAATATTTAGGG - Intergenic
980370998 4:131870998-131871020 TCAAGTTTGAATCAAATATTAGG + Intergenic
982021197 4:151206703-151206725 TTAAACTTGAATTAAATTAAAGG + Intronic
983375630 4:166923924-166923946 CCCTGCTTTAATAAAATTTAGGG - Intronic
984391221 4:179136511-179136533 TCAAGATCTAATAAAATCTATGG + Intergenic
984403014 4:179291065-179291087 CCAATCTTGAATATAAATTAAGG + Intergenic
985177533 4:187217228-187217250 TGAAGCTTGAATCAACTATATGG + Intergenic
987826019 5:23031334-23031356 TCAAGCTTGAAAAAGATGGAAGG - Intergenic
988237935 5:28571165-28571187 TCAAGCCTTAAGAAAACTTATGG + Intergenic
988276264 5:29084532-29084554 GCAACCTTGATTAAAATTTCTGG - Intergenic
988418855 5:30980617-30980639 TCCAGCTTAACTAAAATTTTTGG + Intergenic
989446138 5:41531389-41531411 ATAAGCTTAAATAAAATTTATGG + Intergenic
990769360 5:59225112-59225134 TAAACCTAGAAGAAAATTTAGGG - Intronic
992446470 5:76838715-76838737 TCAAGGTTTCATAAACTTTAGGG + Intergenic
992446499 5:76838998-76839020 CAAGGCTTGAATAAAATGTAGGG - Intergenic
992555794 5:77901827-77901849 TCAAGCATGAAGAAAATATAGGG + Intergenic
992816413 5:80444839-80444861 TAGAGACTGAATAAAATTTAGGG - Intronic
993056820 5:82991042-82991064 CCATGCTTGAATAAAGTTAAGGG - Intergenic
993080768 5:83296524-83296546 TTAAGCATGATTTAAATTTAGGG - Intronic
993276706 5:85868820-85868842 TCAAATCTTAATAAAATTTAAGG + Intergenic
993301083 5:86211011-86211033 TCAACCTTAAATAATATATATGG - Intergenic
993312533 5:86353472-86353494 TCAACCTGGCATAATATTTAAGG + Intergenic
993977978 5:94505450-94505472 TCAAGATTAAATCAAAGTTATGG + Intronic
994502128 5:100592374-100592396 TCTCTCTTGAATGAAATTTATGG - Intergenic
995223691 5:109679946-109679968 TCAAGCTGGACTCAAATTTTTGG + Intergenic
995230996 5:109763252-109763274 TCTATGTTAAATAAAATTTATGG - Intronic
996367202 5:122715789-122715811 TTAAGATTAAAAAAAATTTAAGG + Intergenic
996788254 5:127264660-127264682 CCAAGTTTGAAAAAAATTTCAGG + Intergenic
997432587 5:133851065-133851087 TTAAAATTTAATAAAATTTATGG - Intergenic
999553649 5:152717828-152717850 TTGTGGTTGAATAAAATTTATGG - Intergenic
1000077051 5:157800655-157800677 TTAAGATAAAATAAAATTTAAGG + Intronic
1000128472 5:158271047-158271069 TCATGCTTGAATAATTTTGAAGG + Intergenic
1000897977 5:166879305-166879327 ACAAGATAGAATAAAATTGATGG + Intergenic
1001761513 5:174211796-174211818 CCAATCTTGAATGAAATGTAAGG + Intronic
1003695527 6:8403039-8403061 TCAAGTTTTACTAAAATTTTAGG + Intergenic
1005883837 6:30079881-30079903 TCAAGATTGAAGAAAATCTTTGG - Intergenic
1006798822 6:36746666-36746688 TCAAGAATTAATAAAAGTTAGGG - Intronic
1006992789 6:38229691-38229713 TCAAGCTTGAGAGAAGTTTATGG - Intronic
1007666718 6:43518019-43518041 TAATGCTTGAAAAAAAATTATGG + Intronic
1008672571 6:53786915-53786937 TCAAGTTTGCATGAACTTTATGG + Intergenic
1010111227 6:72235867-72235889 GGAAAATTGAATAAAATTTAGGG + Intronic
1011243722 6:85299790-85299812 ACATGGTTGAAGAAAATTTATGG + Intergenic
1011613554 6:89177311-89177333 GCAAGCTTGAATAAACTTAAAGG - Intergenic
1012004404 6:93694488-93694510 TTAAACTTCAATAAAATTTAGGG - Intergenic
1012043887 6:94244279-94244301 TCAAGTTTAATTAAATTTTAAGG - Intergenic
1012650464 6:101745897-101745919 TAAAGCTTGAACTAAATGTATGG + Intronic
1014647778 6:123995901-123995923 CAAAGCATTAATAAAATTTATGG + Intronic
1014667643 6:124259208-124259230 TCAAATTGGAATAAAATTGATGG + Intronic
1015280609 6:131430434-131430456 TGAACCTTGAATGAAATTCAAGG - Intergenic
1016147955 6:140699604-140699626 TCAAGCTGGAAAATATTTTATGG - Intergenic
1017946833 6:159102891-159102913 TCAAGCTCATATAAAATTCAAGG + Intergenic
1018332863 6:162750206-162750228 TAAGGCTGAAATAAAATTTATGG - Intronic
1020598350 7:10240961-10240983 TCAAGATTTAATAAAACTAAAGG + Intergenic
1020631190 7:10641867-10641889 TCAGGATTTAATAAAATTTCAGG + Intergenic
1021090741 7:16479726-16479748 TCAGGAGTGAATAAATTTTAAGG - Intronic
1021119971 7:16788126-16788148 CCAATCTTGAAGAAAATTCATGG - Intergenic
1021279113 7:18694977-18694999 TAAAGCATGAGGAAAATTTAGGG - Intronic
1022059169 7:26773815-26773837 TTAAGCTTCTATAATATTTATGG - Intronic
1022644826 7:32220316-32220338 TGAAAATTGAATAAAAATTATGG - Intronic
1022690444 7:32646458-32646480 AGAAGCTTGAAGAAAATATAAGG - Intergenic
1022917988 7:34980304-34980326 AGAAGCTTGAAGAAAATATAAGG - Intronic
1024454767 7:49592211-49592233 TTAAACTTTGATAAAATTTAAGG + Intergenic
1027516713 7:79150746-79150768 TCAAGCTTGAAATAAATTTGTGG + Intronic
1028378666 7:90174820-90174842 TAAAACTTGAAGAAAATTAATGG + Intronic
1028783246 7:94761838-94761860 TAAAGCTTGAAATAAATTAAAGG - Intergenic
1030076497 7:105741402-105741424 GCAAGCTTGTATAATGTTTAGGG - Intronic
1030351138 7:108489124-108489146 TCAGTTTTGAATAAAAGTTATGG - Intronic
1031494124 7:122425279-122425301 TCAATCTTTAAAAAAATGTATGG - Intronic
1031570024 7:123347341-123347363 TAAAACTTTAAGAAAATTTAAGG + Intergenic
1032602039 7:133308008-133308030 TAAAACATGAATAAAATGTAAGG + Intronic
1032630955 7:133651294-133651316 TCAAACTTGAATAAATCTAAAGG + Intronic
1032905168 7:136356384-136356406 TTAAAAATGAATAAAATTTATGG + Intergenic
1033725562 7:144112726-144112748 TAAAGCTTTAATATATTTTAGGG - Intergenic
1033735807 7:144220308-144220330 TCAGGCTTGATTAGAATTTAAGG + Intergenic
1033747244 7:144330645-144330667 TCAGGCTTGATTAGAATTTAAGG - Intergenic
1034320625 7:150177938-150177960 TTATCCTTAAATAAAATTTACGG - Intergenic
1035163837 7:156971635-156971657 TCGAGCTAAAATAAAATTTGAGG - Exonic
1039069801 8:33639631-33639653 TCAAGCCTGAATGATATTTCCGG + Intergenic
1039270167 8:35871491-35871513 TCAAACTTGAATATCATCTATGG + Intergenic
1039667891 8:39555862-39555884 TAAAGCTTGTATTAAATTTAAGG + Intergenic
1042335231 8:67623013-67623035 TCAATCTTTGATAAACTTTATGG - Intronic
1042505878 8:69559826-69559848 TCAAGGTTTAATAAAATTAGTGG + Intronic
1042570687 8:70161429-70161451 TCAAACTTGAAGAAAAATGACGG + Intronic
1042686157 8:71443233-71443255 TCTAGCTGGAAAAAAATCTATGG + Intronic
1042740861 8:72044308-72044330 TCAAGCTAAAATAAAAAATATGG + Intronic
1043025597 8:75064038-75064060 TCAACTTTGGATAAAATTTCTGG + Intergenic
1043226063 8:77731846-77731868 TCAAGGTTGAATAAAAGAAATGG - Intergenic
1043562068 8:81504801-81504823 TCAACCTTGAGAAAGATTTATGG - Intergenic
1043658005 8:82696776-82696798 TCAATCTACAATAAAAATTAGGG + Intergenic
1043954993 8:86349467-86349489 TTATACTTAAATAAAATTTATGG - Intronic
1044640000 8:94369234-94369256 TGAAGCTAGCATAATATTTAAGG + Intergenic
1046181161 8:110649954-110649976 ACAATCTTGAATAAAATCTCAGG - Intergenic
1046529973 8:115431876-115431898 TCCAAATGGAATAAAATTTATGG - Intronic
1046978226 8:120307764-120307786 TCAGGGTTGATTAAGATTTAAGG + Intronic
1047138154 8:122105124-122105146 TCCTGCTTGAAAAAAATTTGTGG + Intergenic
1047204178 8:122790197-122790219 TCTAGCTGAAAAAAAATTTAGGG + Intronic
1047356272 8:124125099-124125121 TAAAGATTGAAGAAAATGTATGG + Intergenic
1051167691 9:14282335-14282357 TCATGCTTTAATAATATTTATGG - Intronic
1051200185 9:14609183-14609205 ACAAGCTTTAGTAAAATTAATGG - Intergenic
1052578494 9:30321650-30321672 TCAAGAATTAGTAAAATTTATGG - Intergenic
1053635629 9:39997852-39997874 TCAAGTTTGAATCAAATATTAGG + Intergenic
1054208257 9:62252847-62252869 TCAAGTTTGAATCAAATATTAGG - Intergenic
1054316501 9:63594970-63594992 TCAAGTTTGAATCAAATATTAGG + Intergenic
1054549028 9:66378276-66378298 TCAAGTTTGAATCAAATATTAGG - Intergenic
1054831092 9:69625567-69625589 TCAATCTTGAAGAAATCTTAGGG + Intronic
1055598796 9:77893757-77893779 ACAAGCTTTAAGTAAATTTATGG + Intronic
1055877916 9:80965630-80965652 TCAAGCTGGCAGAAAGTTTAGGG - Intergenic
1056867407 9:90241179-90241201 TGAAGTGTGAATAAAATTAAAGG + Intergenic
1057371911 9:94480793-94480815 TCACTCTTTAACAAAATTTAGGG + Intergenic
1057696792 9:97328861-97328883 TCAAAATTGAATAAAAATTAAGG - Intronic
1059000151 9:110340296-110340318 ATAAGCATGAATAAAATTTCTGG - Intergenic
1059043880 9:110843466-110843488 TCATGCTTGAGGAAATTTTAGGG - Intergenic
1203688139 Un_GL000214v1:15452-15474 TAAAGATTGTATAAAATTTGTGG + Intergenic
1203648136 Un_KI270751v1:88601-88623 TAAAGATTGTATAAAATTTGTGG - Intergenic
1185659690 X:1717540-1717562 TCACGCTTGAAGAAAATCTCTGG - Intergenic
1186613385 X:11160664-11160686 ACTAGCTTGACAAAAATTTATGG - Intronic
1187179499 X:16930221-16930243 TAAAAATTGAATAAAATTTGTGG + Intergenic
1187647149 X:21359955-21359977 TCAAGATTGAATACTCTTTAAGG - Intergenic
1188070094 X:25707414-25707436 TAAAGCTTCATTAACATTTATGG + Intergenic
1188620799 X:32221080-32221102 TCAAGCATAAATTACATTTAGGG + Intronic
1190799874 X:53777649-53777671 TAAAGCTTTAAAAAATTTTAAGG - Intergenic
1192780163 X:74286029-74286051 TCAAGTTTGAATATAATAAAAGG + Intergenic
1193050849 X:77097838-77097860 TCAAGCTAGAAAAAAACTTGAGG - Intergenic
1196886126 X:120247419-120247441 CCAAACTTGAACAAAATTGAGGG - Intergenic
1198260102 X:134958230-134958252 ACAAGTTTGAATAGAATTTTAGG - Intergenic
1199195807 X:145028835-145028857 AGAGGCTTTAATAAAATTTATGG + Intergenic