ID: 951409216

View in Genome Browser
Species Human (GRCh38)
Location 3:22341977-22341999
Sequence ATTAAAAGACTGAATGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 1, 2: 11, 3: 75, 4: 615}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951409214_951409216 13 Left 951409214 3:22341941-22341963 CCAAGTACATAGTTAACACTGAA 0: 1
1: 0
2: 7
3: 73
4: 507
Right 951409216 3:22341977-22341999 ATTAAAAGACTGAATGAGGCCGG 0: 1
1: 1
2: 11
3: 75
4: 615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951409216 Original CRISPR ATTAAAAGACTGAATGAGGC CGG Intronic
900733317 1:4277630-4277652 ATTAAATGAATGAATGAGGCTGG + Intergenic
901414949 1:9110224-9110246 AAAAACATACTGAATGAGGCCGG + Intronic
901522743 1:9797845-9797867 ATAGAAATACTGTATGAGGCGGG + Intronic
901930555 1:12594272-12594294 CTTGAATGAATGAATGAGGCAGG - Intronic
902638233 1:17749254-17749276 GTTCAAAGGCTGAATGAGCCAGG - Intergenic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903851953 1:26312679-26312701 ATTAAAAGAGTGAATGAGGCTGG + Intronic
903928083 1:26845627-26845649 ATTAAAAAAAAGAATGAGGCCGG - Intronic
904100693 1:28024358-28024380 ATTAAAAGATTGAATTAGGCTGG + Intronic
904220963 1:28968665-28968687 ATTATAAAACTAAATGAGGCCGG + Intronic
905344742 1:37303594-37303616 ATTAAAGGAATGAATCAGGCAGG - Intergenic
905571828 1:39012413-39012435 GTTCAAAGAATGAATGAGGCCGG + Intergenic
905821297 1:40993634-40993656 ATTAAAAGAGTAAGTAAGGCTGG - Intronic
906339339 1:44964801-44964823 ATTAAAAGAAGCAATGAGACCGG + Intronic
906428699 1:45736742-45736764 TTTAAAAGGCTGTAGGAGGCGGG + Intronic
906482439 1:46208153-46208175 ATTAAAAAAATAAATAAGGCTGG - Intronic
907123778 1:52031452-52031474 AGTAAAAGATAGAATTAGGCTGG - Intronic
907197580 1:52699163-52699185 AATAAAAGAATGAATGAGGCCGG + Intergenic
907284710 1:53372189-53372211 ATTGAATGAATGAATGAGGGAGG + Intergenic
908175322 1:61549928-61549950 ATCAAAAGACAGAGTGAGCCAGG - Intergenic
908313306 1:62907341-62907363 ATGAAATGACTGACTTAGGCAGG - Intergenic
908581579 1:65522861-65522883 AAAAAAATACTGAATGAGTCAGG + Intronic
909945151 1:81655294-81655316 TTAAAAATACAGAATGAGGCCGG - Intronic
909945906 1:81662849-81662871 TTAAAAAGAATGAATGAGGCTGG - Intronic
910047839 1:82939128-82939150 ATAAAAAGACTGAAAGAAGTGGG - Intergenic
910242587 1:85103589-85103611 ATTAAAATAATTTATGAGGCCGG + Intronic
910810807 1:91234137-91234159 ATGGAAAGACTGTTTGAGGCAGG - Intergenic
910972610 1:92871459-92871481 AATAAAAGAATAAAAGAGGCCGG - Intronic
911316575 1:96363144-96363166 TTAAAAAGACTGCATGGGGCCGG + Intergenic
911552780 1:99304603-99304625 ATTAAAATACTTGAAGAGGCAGG + Intronic
912134475 1:106643596-106643618 TTTTAAAGACAGAATGAGGCTGG + Intergenic
912501674 1:110126771-110126793 ATTGAAACACTGAGTGAGACAGG + Intergenic
912554476 1:110506281-110506303 CTAAAAAGCTTGAATGAGGCTGG - Intergenic
914018453 1:143843214-143843236 ACCAAAAAACTGAATGGGGCCGG - Intergenic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
915253870 1:154610512-154610534 CATAAAAGACAAAATGAGGCCGG + Intronic
915743699 1:158139945-158139967 ATTAAAAGCCTGACTCGGGCGGG - Intergenic
915784585 1:158596256-158596278 CTCAAAAGTCTGAAAGAGGCAGG - Intergenic
915845089 1:159254460-159254482 CTTAAAAGGCAGAGTGAGGCTGG + Intergenic
917068686 1:171125533-171125555 ATTAAAAGACTTGCTGAGGCTGG + Intergenic
917963267 1:180162437-180162459 ATTAAAACACTTAATCAGCCTGG + Intronic
918205739 1:182307592-182307614 ATTAAAAGAATAAAAAAGGCTGG + Intergenic
918724795 1:187906538-187906560 ATTAAACCACTTAATTAGGCAGG - Intergenic
920524096 1:206653312-206653334 ATTGAAAGAAAAAATGAGGCTGG - Intronic
920617707 1:207509916-207509938 ATTAAAAAACAAAATAAGGCCGG + Intronic
920722169 1:208398015-208398037 ATGCAAAAACTGAATGGGGCAGG + Intergenic
920917658 1:210270972-210270994 AATAAAAGACTGACTGAGGCAGG + Intergenic
920945007 1:210520308-210520330 ATTAAAAGACAGAATGGGTCAGG - Intronic
921214194 1:212923452-212923474 TCTTAAAGACTTAATGAGGCCGG + Intergenic
921224004 1:212998820-212998842 ATTAAAAGAAAAAAAGAGGCCGG - Intronic
921525372 1:216210607-216210629 ATTACAAGACTGAATGAAGGAGG - Intronic
921890042 1:220344598-220344620 GGTACAAGGCTGAATGAGGCAGG + Intergenic
921929566 1:220744116-220744138 AGAAAAAGAGAGAATGAGGCAGG - Intergenic
923286911 1:232505081-232505103 ATGAAAAGACTGAAGAAGGAAGG + Intronic
923586529 1:235277683-235277705 ATTAAAATCCTGAAAGATGCTGG - Intronic
924352698 1:243133343-243133365 ATTCAATGAATGAATGAGTCTGG + Intronic
924398792 1:243654613-243654635 AGTAAAAAATTGAAAGAGGCTGG - Intronic
1063111681 10:3043632-3043654 ATTAAAAGATTAAAAGAGCCGGG - Intergenic
1063446532 10:6121486-6121508 CTTGAAAGAATGAATGGGGCGGG + Intergenic
1063591048 10:7395937-7395959 ATTAAAAGGCTGACTGGGCCAGG + Intronic
1063627071 10:7700156-7700178 ATTAAAAAACTAAAACAGGCTGG + Intergenic
1063908181 10:10802174-10802196 ATTAAAAGAATAAAATAGGCTGG + Intergenic
1063935071 10:11068854-11068876 CTTAAAAGAAATAATGAGGCCGG - Intronic
1064349522 10:14564337-14564359 ATTCAGAGACTAAATGTGGCCGG - Intronic
1064611815 10:17111625-17111647 ATTAAAATACTAAATGTGGCTGG + Intronic
1064621511 10:17222227-17222249 ATTAAAAGAATAGATGCGGCTGG - Intergenic
1064737619 10:18398973-18398995 TTTAAAATAATGAATGAGACCGG + Intronic
1064742337 10:18446493-18446515 AGGAAAAGAATCAATGAGGCTGG + Intronic
1065007835 10:21395916-21395938 ATTTAAAAAATAAATGAGGCTGG + Intergenic
1065041082 10:21697168-21697190 ATTAAAAGACAGAAATAGGCCGG + Intronic
1065896322 10:30165906-30165928 ATTAAAAGAAGGGAGGAGGCAGG + Intergenic
1066151152 10:32620217-32620239 ATTAAAAGACACATTGGGGCTGG - Intronic
1066512349 10:36115606-36115628 ATATAAAGACTGTATCAGGCTGG - Intergenic
1066521199 10:36221823-36221845 TGTAAAAGACTTAAGGAGGCAGG + Intergenic
1067074255 10:43164925-43164947 ATTAAAAGTATTAAAGAGGCTGG + Intronic
1067074342 10:43165692-43165714 ATTAAAAGTATTAAAGAGGCTGG + Intronic
1067098493 10:43317893-43317915 TTTAAAGGAATAAATGAGGCTGG + Intergenic
1068038387 10:51790117-51790139 AATTAAAGAATGACTGAGGCTGG - Intronic
1068085323 10:52366822-52366844 ATTAAAACACTGAATTGGCCAGG + Intergenic
1068167850 10:53354644-53354666 ATAAAAATACTGAAAGAGACTGG + Intergenic
1068222471 10:54061926-54061948 CTTTAAAAACTAAATGAGGCCGG + Intronic
1068658294 10:59596601-59596623 CTTAAAAGGCTGACTGGGGCTGG - Intergenic
1069030076 10:63586825-63586847 ATTAAAAGAATTAATAAGCCGGG - Intronic
1069391520 10:67940738-67940760 ATTGAAAGACTAAATTTGGCTGG - Intronic
1069402551 10:68064255-68064277 ATTAAAAGAAAGAAATAGGCCGG + Intronic
1069483005 10:68800888-68800910 ATTAAAATACTGATCTAGGCCGG + Intergenic
1069629878 10:69891021-69891043 ATTAAAAGAAGGAAGGTGGCAGG - Intronic
1070004419 10:72409396-72409418 GCTAAAAGACTGTATTAGGCTGG + Intronic
1070274005 10:74987137-74987159 GTTAAAAGACTAGATGAGGCCGG + Intronic
1070323408 10:75371887-75371909 AAAGATAGACTGAATGAGGCAGG - Intergenic
1070379144 10:75864281-75864303 ATGAAAAGACTGAAGGAAGCCGG + Intronic
1070665619 10:78341212-78341234 AATAAATGACTGAAGCAGGCTGG - Intergenic
1071111774 10:82166313-82166335 ATTAAAAAATTCAATCAGGCCGG - Intronic
1071695991 10:87871796-87871818 ATTAAAAGAGTATCTGAGGCCGG - Intronic
1071967248 10:90864287-90864309 ACTAAAAGAATGGATCAGGCTGG - Intergenic
1072271768 10:93783692-93783714 AATGAATGAATGAATGAGGCAGG - Intronic
1072355893 10:94610296-94610318 ATTAAAGAAATAAATGAGGCCGG + Intronic
1072649223 10:97280877-97280899 CTTAAAAGTCTGTAGGAGGCTGG - Intronic
1073135110 10:101216011-101216033 AATCAGAGACTGAAGGAGGCGGG + Intergenic
1075561158 10:123469612-123469634 TTGAAAAGAATGAATTAGGCCGG + Intergenic
1076477522 10:130762835-130762857 ATTAAAAACCTAAATGGGGCCGG + Intergenic
1076982768 11:213646-213668 ATTAAGAGACTGTCTAAGGCCGG + Intronic
1077853805 11:6101799-6101821 ATTGAAATACTGAATTTGGCAGG + Intergenic
1078470996 11:11586675-11586697 CTTAAAATACTGAAATAGGCCGG + Intronic
1079227605 11:18621005-18621027 TTAAAAACACTGACTGAGGCCGG + Intronic
1079374071 11:19876320-19876342 ATTAAATGAGAAAATGAGGCCGG - Intronic
1079896651 11:26127776-26127798 AATAAAAGAATGAAAGAGGGAGG - Intergenic
1080326130 11:31075840-31075862 AATAAAAGAATGAATGGGCCAGG - Intronic
1080396601 11:31895491-31895513 ATTAAAAAAAAGAAAGAGGCCGG - Intronic
1081195015 11:40150736-40150758 ATTGAAAGTCTAAATCAGGCTGG - Intronic
1081543956 11:44056534-44056556 TTTAAAATACAGGATGAGGCCGG + Intronic
1081879803 11:46438980-46439002 AGTAAAACACAGAATCAGGCTGG + Intronic
1082071177 11:47940900-47940922 GTTGAAAGAATGAATCAGGCCGG - Intergenic
1082776267 11:57246755-57246777 ATTAAAAAAGTAAACGAGGCTGG - Intergenic
1083045835 11:59733976-59733998 AATAAAAGAATGAATGTGGCCGG + Intronic
1083474198 11:62905414-62905436 AGTAAAAGACAGAAGGAGTCTGG + Intergenic
1083699558 11:64466738-64466760 TTAAAAAGTATGAATGAGGCCGG - Intergenic
1083710233 11:64543535-64543557 ATTGAAATAATGAATGAGACTGG + Intergenic
1085874503 11:80389573-80389595 GATACAAAACTGAATGAGGCAGG - Intergenic
1086034072 11:82395452-82395474 ATTAAAAAACTGAACCTGGCTGG - Intergenic
1088249902 11:107853420-107853442 AATGAAAGAATCAATGAGGCCGG + Intronic
1088936929 11:114411452-114411474 ATTAAAAAACAAAATCAGGCTGG - Intronic
1089722864 11:120445600-120445622 ATTTAAAGAGTAAATGAGGCCGG + Intronic
1089788287 11:120923707-120923729 ATTAAATGAGCGAATGGGGCCGG - Intronic
1090205671 11:124882774-124882796 GTTGAGAGGCTGAATGAGGCAGG - Intergenic
1091566631 12:1653532-1653554 TTTAAAAGAATGAGTGAGGAGGG + Intergenic
1091610462 12:2003730-2003752 AATAAAAGACAAAATGGGGCAGG - Intronic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1091904578 12:4174069-4174091 ACTAAAAGACGGAAGGAGCCTGG - Intergenic
1091960891 12:4693211-4693233 AATAAATGAATGAATGAGGTGGG + Exonic
1092736537 12:11588097-11588119 TCTAAAAGACTAAATGTGGCTGG + Intergenic
1092828641 12:12422315-12422337 ATTAAGAAAGTGAAGGAGGCCGG + Intronic
1092840520 12:12536446-12536468 AATAAAAGGCTGAAATAGGCCGG + Intronic
1093159341 12:15727561-15727583 ATTAAAATAAAGAATAAGGCTGG + Intronic
1093260596 12:16932222-16932244 ATTAAAAGACTATAAGTGGCCGG - Intergenic
1093904362 12:24672981-24673003 ATTAAAATACTAAATCTGGCTGG - Intergenic
1094341371 12:29415297-29415319 ATTAGAAGACAGAATCATGCAGG + Intronic
1094465418 12:30749072-30749094 AATAAAAGGCTGAAGGAGGTTGG + Intronic
1095990031 12:48028191-48028213 ATAAAAAGGCTGAATGAGGCCGG + Intergenic
1096736777 12:53661678-53661700 AAAAAAAAAATGAATGAGGCCGG - Intronic
1096856394 12:54487398-54487420 ATAAAAAGGCTCAAGGAGGCCGG - Intergenic
1097151099 12:56980526-56980548 TTTAAAACACGTAATGAGGCTGG - Intergenic
1097333437 12:58356647-58356669 ATGAAAAAAATGAATGAGGCTGG + Intergenic
1098378268 12:69840985-69841007 ATTAAAAGACTGTCTCTGGCTGG - Intronic
1099465895 12:82987751-82987773 ATTAAATGCCTAAATAAGGCAGG + Intronic
1099711615 12:86233031-86233053 GTGAAAAGATTCAATGAGGCAGG + Intronic
1099718202 12:86325579-86325601 ATTAAAATAGTGCTTGAGGCTGG + Intronic
1100105736 12:91169765-91169787 ATTAGAAGACATATTGAGGCCGG + Intronic
1100532166 12:95470893-95470915 ATTAAAATACTTAAGGGGGCTGG + Intergenic
1101022952 12:100572514-100572536 GCTAAAAGACTGAATAGGGCCGG + Intergenic
1102057919 12:109910592-109910614 ATTAAAATAATGCAGGAGGCTGG - Intronic
1102109844 12:110356707-110356729 AGCAAAATAATGAATGAGGCTGG + Intergenic
1102143973 12:110640402-110640424 ATTTAGAGACTGAATGACGATGG - Exonic
1102249839 12:111379229-111379251 ATTAAAAAAAGGAAAGAGGCTGG + Intergenic
1102393760 12:112570566-112570588 ATTGTATAACTGAATGAGGCAGG - Intronic
1102698643 12:114819543-114819565 GTTAAAAAAGTAAATGAGGCCGG + Intergenic
1103679335 12:122680896-122680918 TTTAAAAGAGTGAATTTGGCTGG + Intergenic
1104549583 12:129744146-129744168 ATTAAAATAATGCATGAGACAGG - Intronic
1106607967 13:31249371-31249393 CTGAAAAGACTGGATGAGACAGG - Intronic
1107189934 13:37569299-37569321 ATTAAAAGACTGCTTCAGGGAGG - Exonic
1107346856 13:39471198-39471220 ATAGAAAGACTGAAGGATGCAGG + Intronic
1107470417 13:40686353-40686375 ATTAAAAAAAAGGATGAGGCTGG - Intergenic
1107751503 13:43572143-43572165 AGCAAAATACTGAATCAGGCTGG + Intronic
1108078555 13:46708566-46708588 ATTAAAAGATGGGATCAGGCTGG - Intronic
1108326843 13:49341495-49341517 ATGTATAGACTGAAAGAGGCGGG - Intronic
1108718825 13:53109091-53109113 TATGAAAGTCTGAATGAGGCTGG + Intergenic
1108768231 13:53662210-53662232 ATTAAAAGACCAACTCAGGCCGG - Intergenic
1109114127 13:58359810-58359832 TTCAAAAGCCTGAATTAGGCAGG + Intergenic
1109164729 13:59019817-59019839 ATTATAAAACTTTATGAGGCTGG - Intergenic
1109193149 13:59349196-59349218 TTTAAAAGAGTAACTGAGGCTGG - Intergenic
1111183244 13:84695757-84695779 ATTAAAAGACAGAACAGGGCTGG + Intergenic
1111350551 13:87023614-87023636 ATTAAAAAATTAAATGTGGCCGG + Intergenic
1111586024 13:90285347-90285369 ATTAAAATAATGTATGTGGCCGG - Intergenic
1111996886 13:95174081-95174103 ATTAGGAGACTCAAAGAGGCAGG + Intronic
1112395528 13:99027312-99027334 TTTAGAAGATTAAATGAGGCCGG - Intronic
1114831832 14:26152954-26152976 ATTAAAAGAATTATTGAGACAGG + Intergenic
1114881993 14:26797737-26797759 AATGAAAGACTGAATGTGGGGGG + Intergenic
1114902903 14:27087381-27087403 AGTACACAACTGAATGAGGCAGG - Intergenic
1115196925 14:30811750-30811772 TATAAAAGACTGAATTAGCCAGG + Intergenic
1115552604 14:34518067-34518089 ATTAATAGAAGGAAAGAGGCTGG - Intronic
1115614818 14:35084556-35084578 ATTAAAAGAAAGAACAAGGCTGG + Intronic
1115819285 14:37196962-37196984 TTTAAAAAACTGAAAAAGGCCGG - Intergenic
1116120267 14:40713808-40713830 ATCAATAGACTGAATAAAGCAGG - Intergenic
1116527228 14:45919908-45919930 ATTAGAAGACTGAATGAAGGAGG + Intergenic
1116568217 14:46479216-46479238 ATTTAAAGATTGAATGAGACAGG + Intergenic
1117228946 14:53695319-53695341 AGTTAAGGAGTGAATGAGGCCGG - Intergenic
1117471600 14:56051584-56051606 ATTCAAAGACAGAATGAGCTTGG + Intergenic
1117535885 14:56703016-56703038 ATTAAAAAATTAAATGAGGTTGG + Intronic
1117583121 14:57172808-57172830 ATTAAAAAACAGAAACAGGCCGG - Intergenic
1117815321 14:59592079-59592101 ATTACGAGACTGAATGAAGGGGG - Intergenic
1117829474 14:59735423-59735445 ATTAAAAGACACAAAGTGGCAGG + Intronic
1117922403 14:60738829-60738851 ATTAAGAGCCAAAATGAGGCTGG - Intronic
1118030567 14:61813602-61813624 ATTAGATGAGTGAATGGGGCTGG + Intergenic
1119028775 14:71175257-71175279 AATAAAAGAATGAATCAGGCCGG + Intergenic
1119052829 14:71386950-71386972 ATTAAAAGAAAGACTGTGGCCGG + Intronic
1120018148 14:79497738-79497760 TTAAAAAGCCAGAATGAGGCTGG + Intronic
1120712791 14:87810152-87810174 ATTAAAAGATGGAATGATGAGGG + Intergenic
1120718789 14:87868401-87868423 ATAAAGAGGCTGAAGGAGGCAGG - Intronic
1120818077 14:88883941-88883963 ATTACAAGGCTGAATGAAGGGGG - Intergenic
1121186312 14:91973728-91973750 ATTAAAAAACTAAGAGAGGCCGG + Intronic
1122778285 14:104132681-104132703 ATTGAAAGAGTGAATGAGCGAGG + Intergenic
1123874814 15:24613212-24613234 ATTAAGAAACTAAAGGAGGCTGG + Intergenic
1124172732 15:27390790-27390812 ATAAAAAGACATAATCAGGCCGG + Intronic
1124599908 15:31125432-31125454 ATTAAAAGAATACATGCGGCCGG + Intronic
1125014242 15:34915484-34915506 ATTAAAAGAATAATTCAGGCCGG - Intronic
1125138669 15:36376294-36376316 ATTAAAAGAAATAATCAGGCCGG - Intergenic
1125926290 15:43565844-43565866 CTTAAAAAATTCAATGAGGCAGG - Intronic
1125939434 15:43665394-43665416 CTTAAAAAATTCAATGAGGCAGG - Intronic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126540775 15:49820685-49820707 AATAAATGAATGAATGAGGGAGG - Intergenic
1126761817 15:51976646-51976668 TTTAAAATCCTGAAGGAGGCCGG + Intronic
1127086501 15:55428789-55428811 ATTAAGACAGTGAAAGAGGCTGG - Intronic
1128114917 15:65099298-65099320 ATGCAATGACTGATTGAGGCAGG + Intronic
1128728286 15:70004043-70004065 ATTAAATGACTGAGTCAGGAAGG - Intergenic
1129413759 15:75363507-75363529 GTTGAAAGAATAAATGAGGCTGG + Intronic
1129428941 15:75484107-75484129 ATTAGGAGACTGAATGAAGGGGG - Intronic
1130237071 15:82145533-82145555 ATTAAAACTCTTAACGAGGCTGG + Intronic
1130862621 15:87904450-87904472 ATTAAAAGGCTTATTGTGGCTGG - Intronic
1132132205 15:99292658-99292680 ATAGAAAGACTGTACGAGGCTGG - Intronic
1132539030 16:499307-499329 AGTAAAAGACTTGATGAAGCGGG - Intronic
1132978156 16:2720812-2720834 AATAAAATACTGAATGAGGCCGG - Intergenic
1133384229 16:5355792-5355814 CTTAAAAGAAGGAAAGAGGCTGG + Intergenic
1134847509 16:17452431-17452453 ATTAAAAAAATAATTGAGGCTGG - Intronic
1135560512 16:23472736-23472758 AAAAAAAGACTGAATAGGGCCGG + Intronic
1135623148 16:23973477-23973499 TTAAAAACACTGAAAGAGGCCGG - Intronic
1136046123 16:27616427-27616449 TTTAAAAGAGTACATGAGGCCGG + Intronic
1136061342 16:27728725-27728747 CTTTAAAGGCTGAATGTGGCTGG - Intronic
1136343224 16:29658706-29658728 ATTAAAAGAAAAAAAGAGGCTGG - Intergenic
1137385615 16:48039944-48039966 ATTAAAAGACAAAATTAGACAGG - Intergenic
1137431573 16:48422203-48422225 TTTAAAAGATTACATGAGGCTGG + Intronic
1137435699 16:48452918-48452940 ATTAAAAGAGAGAATGGGGCTGG - Intergenic
1137495895 16:48969095-48969117 CTTAAAAGCCAGGATGAGGCAGG + Intergenic
1138241548 16:55431360-55431382 ATGTAAAGAGTGAATGAAGCCGG - Intronic
1138359610 16:56416736-56416758 ATTCAAAGACTTATTTAGGCTGG - Intronic
1138394673 16:56695035-56695057 ATGAAAAGACTCAGTCAGGCAGG - Intronic
1138965331 16:62077609-62077631 ATTAAAAGAATGAATGATGTAGG + Intergenic
1139016716 16:62698189-62698211 ATTAAAAGAATGAAAGTGGAAGG + Intergenic
1139106002 16:63827137-63827159 ATTTAGAAACTGAATTAGGCAGG + Intergenic
1139479330 16:67220446-67220468 TTTAAAGGATTGAATGAGGCCGG - Intronic
1139552669 16:67684071-67684093 ATTAAAAAAATAATTGAGGCTGG + Intronic
1139634625 16:68250565-68250587 TTTTAAAGAGTGAATGGGGCTGG - Intronic
1139670422 16:68489396-68489418 ATTAATTGACTGACTGAGACAGG - Intergenic
1140061004 16:71569635-71569657 TTTAAATGACTTAATTAGGCAGG - Intronic
1140453584 16:75091045-75091067 GATAAAAGGCTGAATGTGGCTGG - Intronic
1140487272 16:75303531-75303553 ATTAATAAACTGAATGAGCTGGG + Intronic
1140581196 16:76233015-76233037 CTAAAAAGGCTAAATGAGGCTGG - Intergenic
1141060685 16:80865933-80865955 ATTAAAATCTTAAATGAGGCTGG + Intergenic
1141131379 16:81439587-81439609 AATAAAAGAAGGAATGAAGCAGG + Intergenic
1141495974 16:84409911-84409933 ATTAAAAGGCTGGAGTAGGCCGG + Intronic
1142041886 16:87899597-87899619 ATTAAAAGACCTTAAGAGGCTGG - Intronic
1142333461 16:89471054-89471076 TTTAAAAGCATGACTGAGGCTGG + Intronic
1142562965 17:821982-822004 ATTAAAGGAGTAAATGTGGCTGG + Intronic
1142916644 17:3145716-3145738 ATTAAAAGACAGAAGTTGGCAGG - Intergenic
1143127119 17:4649662-4649684 ATCAAAAGTCTACATGAGGCCGG - Intergenic
1143296826 17:5877462-5877484 ATTAAAAGGCCCAAAGAGGCTGG - Intronic
1143952160 17:10641808-10641830 ATTGAAAGCCTGAGTTAGGCCGG - Intronic
1144099838 17:11933674-11933696 ATTAAAAGCCTGAAGAAGGCCGG - Intronic
1144170386 17:12654406-12654428 AAGAAAAGACTGCATGAGCCAGG + Intergenic
1144671835 17:17137216-17137238 ATTAAAAGACTGAAGGGGCCGGG + Intronic
1145348547 17:22057400-22057422 CTTAAGGGACTGCATGAGGCAGG + Intergenic
1145359650 17:22201706-22201728 ATCAAAAGACTATATCAGGCCGG + Intergenic
1145963662 17:28902225-28902247 AGAAAAAGATTTAATGAGGCTGG - Intronic
1146388543 17:32399858-32399880 ACTAAAATAATGTATGAGGCTGG + Intergenic
1146713352 17:35062106-35062128 ATAAAAAGAATGAACAAGGCCGG + Intronic
1146980630 17:37158330-37158352 TTTAAAAGACTGGATGAGGCTGG + Intronic
1148027152 17:44596166-44596188 ATTAAATGATTGAATGGGACAGG - Intergenic
1148140173 17:45322603-45322625 ATAAAAATTCAGAATGAGGCTGG - Intergenic
1148373064 17:47115468-47115490 ATTAAAAGGATGCTTGAGGCTGG + Intergenic
1148401242 17:47363361-47363383 ATTAAGTGAATGAATCAGGCTGG - Intronic
1148516677 17:48225292-48225314 ATTAAAGGACTGAATATAGCAGG + Intronic
1148771351 17:50068796-50068818 TAAAAAAGACTGATTGAGGCTGG - Intronic
1149261622 17:54886411-54886433 ATTAATAGAATGAATGAGGATGG - Intergenic
1149924554 17:60690271-60690293 TTTTAAAGGCTGAATGAGGCAGG + Intronic
1149940706 17:60862295-60862317 AACAAAAAACAGAATGAGGCTGG + Intronic
1149969677 17:61204193-61204215 AATAAAACACTGAAAGAGGAGGG - Intronic
1149979805 17:61301335-61301357 ATGAAAAGACTGATTTCGGCCGG + Intronic
1150341767 17:64374191-64374213 GTTTAAAGACTGAAATAGGCTGG + Intronic
1150728853 17:67674205-67674227 ATTAAAAAATTGAATCAGGCTGG + Intronic
1150995533 17:70313283-70313305 AATAAAAGAATGAATGAGTACGG - Intergenic
1151056259 17:71035091-71035113 ATTAAAATACTGTATGAAGAGGG - Intergenic
1151064647 17:71135770-71135792 ATTTTATGACTGACTGAGGCAGG - Intergenic
1151144579 17:72029224-72029246 ATTAAAAGACTGTCAGAGACAGG + Intergenic
1151525081 17:74659550-74659572 ATTAAATGAAAGAATGCGGCCGG - Intergenic
1151536134 17:74739825-74739847 ATTAAAAGGTTGCATGAGGCCGG - Intronic
1151578780 17:74965988-74966010 AATAAAAGACTAGAAGAGGCTGG + Intronic
1154932578 18:21015673-21015695 ATTAAAAGAGACAATTAGGCTGG + Intronic
1155681873 18:28497164-28497186 TTTACAAGACTGAATGAAACAGG - Intergenic
1157071128 18:44409951-44409973 ATTGATAGACTGAATAAAGCAGG - Intergenic
1157350168 18:46876994-46877016 ATTAAATTAGTGAAGGAGGCCGG - Intronic
1157840486 18:50953392-50953414 GGTAAAAGACTAAGTGAGGCCGG - Exonic
1159144490 18:64436586-64436608 TTCAAAAGACCAAATGAGGCCGG + Intergenic
1160183260 18:76654482-76654504 ATTATGAGACTGAATGAAGGGGG + Intergenic
1161309106 19:3584301-3584323 TTTAAAAAACTGAATGCGGCCGG + Intergenic
1161390516 19:4018106-4018128 TTTAAAAGGCTGACTGGGGCCGG - Intronic
1161490855 19:4560428-4560450 ATAATAAGAATGAAGGAGGCTGG - Intergenic
1161491191 19:4562665-4562687 ATAATAAGAATGAAGGAGGCTGG - Intergenic
1161491435 19:4564141-4564163 ATAATAAGAATGAAGGAGGCTGG - Intergenic
1161618283 19:5284644-5284666 ACTAAAAAACAGCATGAGGCTGG + Intronic
1161696049 19:5768839-5768861 TTTAAAAGACTACCTGAGGCTGG + Intronic
1162357937 19:10198332-10198354 TTTTAAAGACTGAATTAGGCTGG - Intronic
1163532154 19:17856406-17856428 TTTAAAAGATTGCATAAGGCCGG + Intergenic
1163706174 19:18814746-18814768 AAAAAAAAAATGAATGAGGCTGG - Intergenic
1163864271 19:19759185-19759207 ATAAAAAGACACATTGAGGCCGG - Intergenic
1164319124 19:24123840-24123862 AAAAAAAGACTGGAAGAGGCAGG - Intronic
1165036863 19:33040044-33040066 TTTAAATGAGTGAATGGGGCTGG - Intronic
1165356800 19:35309574-35309596 CTCAAAACACTGAAAGAGGCCGG - Intronic
1165399828 19:35591618-35591640 ATTAAAAGAATAATAGAGGCCGG - Intergenic
1166773005 19:45295665-45295687 CTCAGAAGGCTGAATGAGGCAGG + Intronic
1166801455 19:45460298-45460320 AATATAAGAATAAATGAGGCAGG - Intronic
1166832444 19:45646553-45646575 TTTGAATGAATGAATGAGGCAGG - Intergenic
1166867094 19:45845938-45845960 TTTAAAATAGTGAATTAGGCCGG + Intronic
1167015282 19:46837298-46837320 ATTAAAAGACTTGACCAGGCTGG - Intergenic
1168331058 19:55569032-55569054 AATGGAAGACTGAATGAGGCCGG + Intergenic
1168567649 19:57438494-57438516 ATTACGAGACTGAATGAAGGGGG - Intronic
925535880 2:4916103-4916125 AATAAAATGCTGAATGAGGAGGG + Intergenic
926921987 2:17948062-17948084 AATAAAATATGGAATGAGGCTGG + Intronic
927051673 2:19336411-19336433 TTTAAAACACTGAATATGGCTGG - Intergenic
927281374 2:21311501-21311523 ATTTAAAGACTGAAACCGGCTGG - Intergenic
928069564 2:28201065-28201087 ATTAAAAAACTCACAGAGGCCGG - Intronic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
930635263 2:53797898-53797920 TTTAAAATACTGAAATAGGCTGG + Intronic
930643088 2:53874642-53874664 AATAAAAGGTTGAATGAGGCTGG + Intronic
931740242 2:65236056-65236078 TTTAAAAGACTAAGTGGGGCCGG + Intronic
931853794 2:66280645-66280667 ATGAAAAGACTGGAGGATGCAGG - Intergenic
932099439 2:68884149-68884171 ATTAAAAGAATAGGTGAGGCAGG + Intergenic
932368828 2:71170945-71170967 AATAAAATACTGAAAGTGGCTGG + Intergenic
935115551 2:100132848-100132870 TTTAAAAAATTGAATGATGCTGG + Intronic
935761704 2:106326421-106326443 ATTTAGAGACTGAAAGATGCAGG - Intergenic
936448960 2:112619066-112619088 ATAAAAGGATGGAATGAGGCTGG - Intergenic
936918343 2:117662801-117662823 ATTAAAAGCCTGCAATAGGCTGG + Intergenic
938023864 2:127927972-127927994 TTTAAAAGACAGAATGGGGTGGG + Intergenic
938141309 2:128796852-128796874 CTTATAAGACTCCATGAGGCAGG - Intergenic
938418239 2:131122209-131122231 TTTAAAACACAGTATGAGGCCGG - Intronic
938599151 2:132819709-132819731 ATTTAAAGAGGGAATGAGGATGG + Intronic
938607963 2:132915815-132915837 ATTAAGAAACTGAGTGTGGCTGG - Intronic
938890935 2:135704753-135704775 ATTAAAACTCTGTAAGAGGCTGG - Intronic
940930893 2:159429411-159429433 AATAAAACACTGTATAAGGCAGG + Intronic
941084703 2:161103902-161103924 ATTAAAATATTGAAGGATGCAGG + Intergenic
941238546 2:163007839-163007861 AATAGAAGACTGAATGAGCTAGG - Intergenic
941280699 2:163547244-163547266 TTTAAAAAATTGAAGGAGGCCGG - Intergenic
941789640 2:169537680-169537702 ATTAAAAAACTGATTAAGTCCGG - Intronic
941822760 2:169858894-169858916 TTTAAAGTACTAAATGAGGCCGG - Intronic
941871425 2:170389798-170389820 CCTAATAGACTGAATGAGGATGG - Intronic
942160269 2:173178345-173178367 ATTTAAAAATTGAATTAGGCTGG + Intronic
942372980 2:175306150-175306172 TTTAAAAGAATGGTTGAGGCTGG + Intergenic
942755206 2:179332685-179332707 ATTCTAAGAATGCATGAGGCAGG + Intergenic
942756190 2:179344083-179344105 AGTAAAAGAATGAAGCAGGCTGG - Intergenic
942770730 2:179515072-179515094 ATTAAAAAACATATTGAGGCTGG - Intronic
943193000 2:184704807-184704829 ATAAAAAGCCTGAATGACACTGG + Intronic
943555369 2:189396685-189396707 AAAAAAAGAATAAATGAGGCCGG + Intergenic
943790418 2:191925403-191925425 CTTGAGAGACTGAGTGAGGCAGG + Intergenic
944804172 2:203264575-203264597 ATTAAAAGATTAAAATAGGCTGG - Intronic
945654067 2:212602280-212602302 TTTAAATGGCTGAATGAGGATGG + Intergenic
946746917 2:222855259-222855281 ATTAAAAGAACTAAAGAGGCAGG - Intergenic
946900096 2:224364128-224364150 ATAAAAAGACAAAATGAGCCTGG - Intergenic
946995675 2:225388591-225388613 ATTAAAAAAAAAAATGAGGCTGG + Intergenic
947021331 2:225679787-225679809 ATTAAAAAATTAAATCAGGCCGG - Intergenic
947518183 2:230824854-230824876 ATGAAAAGAATGACAGAGGCCGG + Intergenic
947622003 2:231596785-231596807 ATTGAAAGCATGAGTGAGGCTGG - Intergenic
947757534 2:232578334-232578356 ATTAAGTATCTGAATGAGGCTGG + Intronic
947799894 2:232922275-232922297 TTCAAAATCCTGAATGAGGCTGG + Intronic
948016298 2:234693397-234693419 ATTAAAATCCTGAATGTGGCCGG - Intergenic
949081774 2:242106562-242106584 ATGAAAATATTGCATGAGGCTGG + Intergenic
1169051705 20:2584146-2584168 ATGAAAAGATATAATGAGGCCGG + Intronic
1169915448 20:10678200-10678222 ATTTTAAGAGTGAATGAGGCTGG + Intergenic
1171965956 20:31530703-31530725 TTAAAAAGAATGAAAGAGGCTGG - Intronic
1172730940 20:37087038-37087060 ATTAAAAGAGGGGATGAGGGTGG + Intronic
1173198216 20:40933343-40933365 AATAAAGGAATGAATGAGGCCGG - Intergenic
1173550528 20:43930177-43930199 ATTGAATGAATGAATGAGGCAGG + Intronic
1173776827 20:45715533-45715555 ATAAAAAGACTGAACCAGCCAGG + Intergenic
1173972888 20:47166038-47166060 AGAAAAAAAATGAATGAGGCAGG + Intronic
1174089988 20:48039198-48039220 ATAAAAAGACAAAATGTGGCCGG + Intergenic
1174228630 20:49025675-49025697 ATAAAAAGACAAATTGAGGCCGG + Intronic
1174270037 20:49361429-49361451 ATTAAAAAACATAATAAGGCTGG + Intergenic
1174469031 20:50741840-50741862 CTTAAAAGACAGAGTGCGGCCGG - Intronic
1174552238 20:51370374-51370396 CATAAATGAATGAATGAGGCTGG - Intergenic
1174710885 20:52703818-52703840 AATGAAAAACTGAATGAGGCCGG + Intergenic
1174854709 20:54032510-54032532 ATTAAAAGACATAAAGTGGCAGG + Intronic
1177445916 21:21196283-21196305 ATCCAATGACTGATTGAGGCTGG + Intronic
1178235592 21:30837432-30837454 ATTAAAATACTCAAATAGGCCGG - Intergenic
1179141732 21:38731979-38732001 ATCATAAGACTGACAGAGGCAGG + Intergenic
1179551930 21:42148968-42148990 ATTAAAAGGCTGGGTTAGGCGGG + Intergenic
1179966525 21:44809999-44810021 ATAAGAAGGCTGCATGAGGCCGG + Intronic
1180732511 22:17992741-17992763 AGAAAAAGACAGTATGAGGCAGG - Intronic
1181261080 22:21598087-21598109 ATTAAAATAAGAAATGAGGCAGG - Intronic
1181517250 22:23422056-23422078 AGAAAAAGACAGTATGAGGCAGG - Intergenic
1181617137 22:24062653-24062675 TTTAAAAGTCAGAATGAAGCTGG - Intronic
1181656634 22:24306201-24306223 ATAAAAAGAATGTATAAGGCCGG - Intronic
1181768552 22:25109819-25109841 AATGAAAGAATGAATGAGGCTGG + Intronic
1182089529 22:27584583-27584605 ATTAAATGAATGAATGAGATTGG + Intergenic
1182720756 22:32397191-32397213 ACTACAGGACTGAATGAAGCGGG - Intronic
1183208349 22:36434530-36434552 AAGAAATGAGTGAATGAGGCCGG - Intergenic
1183579208 22:38713453-38713475 AATAACAGCCTGAATCAGGCTGG + Intronic
1183874995 22:40772597-40772619 ACTAAAAGACAAAATTAGGCTGG - Intronic
1183954397 22:41370706-41370728 ACTAGAAAACGGAATGAGGCTGG - Intronic
1183974936 22:41506547-41506569 TATAAAAAACAGAATGAGGCCGG - Intronic
949152274 3:783872-783894 TTTAAAAGAGTGATTGGGGCTGG - Intergenic
949516712 3:4814118-4814140 ATGAAAAGACTGTTTGCGGCTGG + Intronic
949634828 3:5971354-5971376 ATTAAAAGGCTTTATTAGGCTGG + Intergenic
949915610 3:8961658-8961680 ATTAAAATACTGAAAGGGGCTGG + Intronic
950911106 3:16592971-16592993 ATTCAAATATTGAATTAGGCAGG - Intronic
951046208 3:18041264-18041286 AATAAAGGAATAAATGAGGCTGG - Intronic
951409216 3:22341977-22341999 ATTAAAAGACTGAATGAGGCCGG + Intronic
951432201 3:22621409-22621431 AGTAAGAAAGTGAATGAGGCTGG + Intergenic
951795830 3:26537592-26537614 ATTAAAAAACAGAATGAGTTTGG + Intergenic
952167879 3:30770728-30770750 ATTAAAATAAAGAATGAAGCTGG - Intronic
952610070 3:35198264-35198286 ATTTAAAGCCTGAATGAAACAGG - Intergenic
953198099 3:40752903-40752925 TTTTGAAGACTGTATGAGGCAGG + Intergenic
953212723 3:40890708-40890730 ATCAAGAGACAGAATTAGGCCGG + Intergenic
954618272 3:51981407-51981429 GTTATAGGACTGAATGAGTCTGG + Intronic
955228149 3:57078072-57078094 CTTAAAATACTGACTGGGGCAGG - Intronic
955427312 3:58805462-58805484 ATTAAAAGACAGAAAGAGATAGG - Intronic
955509832 3:59668370-59668392 TTTAAAAGACAGAATGAGTCAGG - Intergenic
955661723 3:61306789-61306811 ATTAAAAGACATAGTGAGGTTGG - Intergenic
957170611 3:76732243-76732265 CTTAGAAGACTGAAGGAGACTGG + Intronic
957476884 3:80737101-80737123 ATTAAAAGACTGTATAAGATTGG - Intergenic
957625971 3:82652098-82652120 ATTGTAAGACTGAATGTGGTAGG + Intergenic
958012146 3:87893528-87893550 ATTAAAAGACTGCTAGAGGTAGG + Intergenic
958022914 3:88017539-88017561 TTTAAAAGAATGAATAAGGCCGG - Intergenic
958047337 3:88302028-88302050 AATAAAAGAACAAATGAGGCTGG - Intergenic
958658975 3:97041624-97041646 ATTAAAAGACTACCTGAGACTGG + Intronic
959394378 3:105819188-105819210 ATCAAAACACATAATGAGGCCGG + Intronic
959527939 3:107398537-107398559 ATGAAAAGTCTGAATGAAACTGG - Intergenic
959542523 3:107556529-107556551 ATTAACAGAACCAATGAGGCTGG + Intronic
959561542 3:107788484-107788506 AGTTTAAGACAGAATGAGGCTGG + Intronic
959638160 3:108599636-108599658 ATTTCAACACTGAATGAGGGGGG - Intronic
960080042 3:113532011-113532033 ATTTAAAGAGTTAAAGAGGCAGG - Intergenic
960500927 3:118437373-118437395 ATTAAAGGACCAAATAAGGCAGG + Intergenic
960540408 3:118855302-118855324 ATAAAAAGAATGAAAGAGGCTGG + Intergenic
960862946 3:122169793-122169815 ATTACAAGACTGAATGAAGGGGG + Intergenic
961093891 3:124138544-124138566 ATGAAAAGAGTGACTGAGGCAGG + Intronic
961677127 3:128574455-128574477 ATTAAAAGACAAAATGAGGCCGG + Intronic
962041454 3:131711656-131711678 ATTCACAGACAAAATGAGGCCGG - Intronic
962137255 3:132747778-132747800 TTTAAAATGCTGAAAGAGGCTGG - Intergenic
962306851 3:134295206-134295228 AATAATTGAATGAATGAGGCAGG - Intergenic
962565802 3:136658024-136658046 ATTTAAAAACAAAATGAGGCTGG + Intronic
963047326 3:141112347-141112369 ATCAAAAGACAGAAGGAGGCCGG + Intronic
963743576 3:149103601-149103623 ATTAAGATACTGAAAAAGGCCGG + Intergenic
963813821 3:149807930-149807952 ATTAAGAGGCTGTAAGAGGCCGG - Intronic
964255291 3:154768449-154768471 TTAAAAAGACTGTAGGAGGCCGG + Intergenic
964457919 3:156888532-156888554 ATAAAAAGACTGAAAGGGCCTGG + Intronic
964858650 3:161175068-161175090 ATAAAAAAACAAAATGAGGCTGG - Intronic
965740446 3:171868828-171868850 AATGAAAAACTGAATCAGGCCGG + Intronic
966843930 3:184111689-184111711 CTTAAAAGACTTCATGAGGCTGG - Intergenic
967731248 3:192908957-192908979 ATTAAAATACAAAATGCGGCCGG + Intronic
967732775 3:192921242-192921264 TATAAAAGAATGAATGAAGCCGG + Intergenic
967790496 3:193543525-193543547 ATCAAAAGACTATATGAGGTTGG - Intronic
968179302 3:196579853-196579875 AATAAAAGAATAAATCAGGCAGG - Intronic
968853132 4:3097334-3097356 TTAAAAGGACTGTATGAGGCAGG + Intronic
969085068 4:4650422-4650444 ATTAACACAGAGAATGAGGCTGG - Intergenic
969394964 4:6914741-6914763 ATTAAAAAAGAGAAAGAGGCTGG + Intronic
969633237 4:8350702-8350724 ATTAAAGGAATGAATTGGGCAGG - Intergenic
970458734 4:16251570-16251592 ATTAGAAGACTGGAGAAGGCCGG - Intergenic
971006065 4:22375385-22375407 AATAAAAAACTAAATGAGGGCGG + Intronic
971011665 4:22444558-22444580 CTTAAAAGACTGATACAGGCAGG - Intronic
971296071 4:25393363-25393385 GTTAAAAGAGTGATTGAGGCTGG + Intronic
971511066 4:27424568-27424590 AGGGAAAGACTAAATGAGGCTGG - Intergenic
972079177 4:35128389-35128411 CTTAAAAGTATGAGTGAGGCTGG + Intergenic
972100104 4:35405261-35405283 AGCAAAAGAATGTATGAGGCTGG + Intergenic
972716225 4:41649101-41649123 TTTAAAAGGCCTAATGAGGCTGG + Intronic
973108708 4:46373744-46373766 CTTAAGAGACTAAATGGGGCAGG - Intronic
973211226 4:47617838-47617860 ATTAAAAGACTGACAGAGCAGGG + Intronic
973827087 4:54719095-54719117 AATAAAAGACTAAATGAAGAGGG - Intronic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
975583294 4:75926263-75926285 ATTAAAAGACAGTATTAGCCAGG + Intronic
976119218 4:81761633-81761655 ATTGAAGTACTGGATGAGGCTGG + Intronic
976315397 4:83654241-83654263 TTAAAAAGACTGAACAAGGCGGG - Intergenic
976425263 4:84895959-84895981 AATAAAAGGATGAAAGAGGCTGG + Intronic
977619433 4:99119917-99119939 ATTAGAAGACTGATAGAGACAGG + Intergenic
979207378 4:118055090-118055112 ACTAAAAGATTGAGTGTGGCAGG + Intronic
979249250 4:118547178-118547200 ATTCAATGAATGAATGAGTCTGG - Intergenic
979488936 4:121301961-121301983 ATTTAAAAAATGTATGAGGCTGG + Intergenic
980324917 4:131330737-131330759 TTTAAAACATTGAATTAGGCTGG - Intergenic
980475705 4:133311565-133311587 ATTAAAACACTATATCAGGCCGG - Intergenic
980577347 4:134701007-134701029 ATTAAAAGACATAATGAAGTTGG + Intergenic
980827859 4:138093607-138093629 ATTAAAAGCCTGAAAGATGTTGG - Intergenic
981118811 4:141024051-141024073 AACTAAAAACTGAATGAGGCTGG + Intronic
981671234 4:147289370-147289392 AATAAAAGCTTGACTGAGGCTGG + Intergenic
983278194 4:165644514-165644536 CTAAAATGACTGAATTAGGCCGG - Intergenic
983590335 4:169403269-169403291 ATTACAAGACTAATTTAGGCTGG + Intronic
983627741 4:169819290-169819312 ATTACAAGACTGAACGAGGCCGG + Intergenic
983830267 4:172318404-172318426 TTTGAAAGGCTGAATGAGGCTGG + Intronic
984005600 4:174303074-174303096 TTTAAAAGACTATTTGAGGCTGG - Intronic
984191173 4:176607424-176607446 ATTAAAACATTGAATGTGTCAGG - Intergenic
984243162 4:177242004-177242026 AGTAAGAAAGTGAATGAGGCCGG - Intergenic
985250509 4:188019854-188019876 ATTAAAATACTGTATGAGGCTGG + Intergenic
985335450 4:188887918-188887940 ATTAAGAGACATAAAGAGGCTGG - Intergenic
985344735 4:188991997-188992019 ACTAAAAAAATCAATGAGGCCGG + Intergenic
987043183 5:14082465-14082487 GTTAAATCACTGAATGAGGATGG - Intergenic
987473668 5:18363840-18363862 ATTAAAACACTTAATTTGGCCGG - Intergenic
987693610 5:21300060-21300082 ATTGAAAGTCTTAGTGAGGCAGG - Intergenic
988320723 5:29692718-29692740 ATTAAAAGACTAAATGAGACTGG + Intergenic
988677032 5:33442798-33442820 TTAAGAAGACTGAATGAGGCCGG - Intronic
988933334 5:36058785-36058807 ATTACGAGACTGAATGAAGGAGG - Intronic
988969454 5:36451490-36451512 ATTAAAAAGCTAAAAGAGGCTGG - Intergenic
989161006 5:38391691-38391713 ATTAAAACACTGTGTAAGGCCGG - Intronic
990284817 5:54290600-54290622 ATTAAAATATTGAGTGATGCTGG - Intronic
990817800 5:59805087-59805109 ATTAAGAAACAGAATGTGGCAGG - Intronic
991022108 5:61990191-61990213 ACTAAAAAACTGAATGACGCTGG + Intergenic
991062705 5:62395705-62395727 ATTAAAAGATAAAATAAGGCTGG + Intronic
991308923 5:65213343-65213365 CTAAAAATACTGAATTAGGCTGG + Intronic
991370611 5:65915802-65915824 TTTAAAAGACTAAAACAGGCTGG - Intergenic
991890596 5:71328745-71328767 ATTGAAAGTCTTAGTGAGGCAGG + Intergenic
991904192 5:71492010-71492032 AGAAAAATACTGCATGAGGCTGG - Intronic
992225450 5:74616040-74616062 ATTAAAAGTCTTAAGGAGGGAGG - Intergenic
992458620 5:76939807-76939829 ATTGAAAAAATGAATTAGGCTGG - Intergenic
992640318 5:78763383-78763405 ATTAAATGACAGAAGGAGGCTGG - Intronic
993329966 5:86587400-86587422 ATTAATAGTATGAATGGGGCTGG + Intergenic
993556902 5:89350914-89350936 ATTAATAGTATGAATGAGGGAGG + Intergenic
994564414 5:101423466-101423488 ATCAAAAGAAAGAATGAGTCAGG + Intergenic
994846527 5:104995258-104995280 ATTCAAAAACTGACAGAGGCTGG - Intergenic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995894521 5:116997322-116997344 TTAAAAAGACTAGATGAGGCCGG + Intergenic
995958832 5:117814286-117814308 ATTAACAACCTGAATGAGCCTGG + Intergenic
996987269 5:129582865-129582887 ATTAAAAGACAGACTGGGCCGGG - Intronic
997146080 5:131434533-131434555 TTTAAAAAACTGAAACAGGCTGG - Intronic
997324572 5:133009297-133009319 TTTAAGAGACAGAATCAGGCAGG - Intronic
997332860 5:133079032-133079054 GTTAAAAGACTAAATGAAGGGGG - Intronic
997842216 5:137252220-137252242 ATTAAGAAAGTGAATTAGGCTGG - Intronic
999086928 5:148900926-148900948 ATCAAGAGAGAGAATGAGGCAGG + Intergenic
999256606 5:150213154-150213176 ATTAGAGGACTGAGTGAGGGTGG - Intronic
999682156 5:154070429-154070451 AAAAAAAGATAGAATGAGGCAGG + Intronic
999779306 5:154836192-154836214 ATTAAAAGTCAGAAAGTGGCCGG - Intronic
1000558917 5:162761400-162761422 ATAAAAACACTAAATGAGCCAGG - Intergenic
1000870839 5:166575130-166575152 ATTAAAAAGCTGAATGGGGAGGG + Intergenic
1000935184 5:167298305-167298327 ATTGAAAAACTAAATGGGGCCGG + Intronic
1001835399 5:174827055-174827077 ATTAAAAGTTAAAATGAGGCCGG + Intergenic
1002255823 5:177958075-177958097 ATTAAAATACAAAAGGAGGCCGG - Intergenic
1002506135 5:179680355-179680377 ATCAAATGACTGAATGATGAGGG - Intronic
1002556362 5:180044925-180044947 CTTAAGAGACTGAAGGAGGGAGG + Intronic
1002720106 5:181253992-181254014 ATTGAAAGAAAGAAAGAGGCCGG + Intergenic
1003214673 6:4098464-4098486 AATAAAAGAATGAACAAGGCCGG - Intronic
1004221866 6:13754107-13754129 AATGAAACAATGAATGAGGCCGG - Intergenic
1004570894 6:16844004-16844026 TAGAAAGGACTGAATGAGGCCGG - Intergenic
1004675056 6:17833557-17833579 CTTAAAAGACTTTCTGAGGCTGG + Intronic
1004747213 6:18522950-18522972 AGTAAAAGATGGAATCAGGCGGG + Intergenic
1004780154 6:18899219-18899241 ATTAAAAGAATGACAGTGGCTGG - Intergenic
1005003850 6:21269058-21269080 AATTAAAGGATGAATGAGGCCGG + Intergenic
1005297734 6:24443146-24443168 ATTACAAGACTGAACGAAGGAGG + Intronic
1005557299 6:26999878-26999900 ATTGAAAGTCTTAGTGAGGCAGG + Intergenic
1005579918 6:27224015-27224037 ACTAAAATGCTGATTGAGGCTGG + Intergenic
1005741953 6:28800483-28800505 ATCAAAAGGATGAAGGAGGCTGG + Intergenic
1005754817 6:28916835-28916857 ATTAAAAAAATGAAGAAGGCTGG + Intronic
1005845017 6:29770264-29770286 ATTACAAAGCTGAAGGAGGCGGG + Intergenic
1006560054 6:34903430-34903452 CTCAAAAGACTGAGTGAGGTTGG - Intronic
1007680880 6:43632553-43632575 ATTAAAATACTGGATCTGGCTGG - Intronic
1008005971 6:46409693-46409715 ATTAAAAGAATGTATGATGGAGG - Intronic
1008583975 6:52932326-52932348 ATTAAAAATCTAATTGAGGCCGG - Intergenic
1008597078 6:53053155-53053177 AATAAAAGACTCAAGGAAGCTGG - Intronic
1008639112 6:53443408-53443430 ATTAAGACACAGATTGAGGCTGG + Intergenic
1008693307 6:54005240-54005262 GTTATAAGAATGGATGAGGCTGG - Intronic
1010060364 6:71615644-71615666 AATAAGAGAGTGAGTGAGGCTGG - Intergenic
1010448511 6:75976266-75976288 ATCAAAAGGCTGAGAGAGGCTGG + Intronic
1011172483 6:84521511-84521533 TTTAAAAGGCTGAAAGAGGGAGG + Intergenic
1011438174 6:87360695-87360717 CTTAAAAGAATTAATGAGGCTGG - Intronic
1011463399 6:87630131-87630153 CTTAAAAGAGAGACTGAGGCTGG + Intronic
1011501090 6:87990809-87990831 ATTCAGTGACTGGATGAGGCTGG + Intergenic
1011615342 6:89192854-89192876 TATAAAAGAGTCAATGAGGCCGG - Intronic
1012197194 6:96358144-96358166 CTTTAAAGACTAAATGTGGCTGG + Intergenic
1012409393 6:98938784-98938806 ATTCAAAACCTGACTGAGGCTGG + Intronic
1012452931 6:99372710-99372732 ATAAAATGACAGACTGAGGCCGG - Intronic
1012993731 6:105951970-105951992 TTTAAAAGGCTACATGAGGCTGG + Intergenic
1013579905 6:111523377-111523399 CTAAAAAGACAGAATCAGGCCGG - Intergenic
1013967157 6:115968685-115968707 ATTAAAAGACTGGATGAAGGGGG - Exonic
1014049734 6:116938009-116938031 TTTAAAAAACGGAATTAGGCTGG + Intergenic
1014934584 6:127372649-127372671 ATTAAATAACTCAATAAGGCTGG - Intergenic
1015549641 6:134398765-134398787 AATAAAAAACTGCCTGAGGCTGG - Intergenic
1017398725 6:154034246-154034268 ATTTAAAGAATGACTGAGGCCGG + Intronic
1018620073 6:165721757-165721779 ATTAAAAGATGGTATGAGACAGG - Intronic
1018728669 6:166632665-166632687 ATAAAAAGAATGAATGAGGAAGG + Intronic
1019008222 6:168821527-168821549 ATTAAAAGTTTTAATGGGGCTGG + Intergenic
1019163505 6:170084457-170084479 AAAAAAAGGCTGAATGTGGCCGG + Intergenic
1019452974 7:1109179-1109201 ATAAAAATACTGGAAGAGGCTGG - Intronic
1020088029 7:5321965-5321987 ATTAAAAAAAAGAAAGAGGCCGG - Intronic
1020453185 7:8343269-8343291 GTTGAAAGAGTGAATGAGGCAGG + Intergenic
1020457790 7:8394191-8394213 ATAAAATGTCTGAAGGAGGCTGG + Intergenic
1020669272 7:11086288-11086310 ACAAAAAGACAGACTGAGGCTGG - Intronic
1020934207 7:14439970-14439992 ATTACAAGACTGAATGAAGGAGG + Intronic
1020967277 7:14887170-14887192 AGCAAAAGCCTGATTGAGGCAGG - Intronic
1021247321 7:18279759-18279781 ATTAAATGAGTAAATGTGGCTGG - Intronic
1021256665 7:18400570-18400592 TTGAAAAGACTGGATGAGGAAGG + Intronic
1021256825 7:18402489-18402511 AGTAAAAGACTGAGTGAGGTGGG + Intronic
1022066267 7:26861166-26861188 ATTAAACAAATGAAGGAGGCTGG + Intronic
1022436780 7:30394435-30394457 TTTAAAATACTGAAATAGGCTGG - Intronic
1023081559 7:36531642-36531664 TGTAAAAGACTTATTGAGGCTGG - Intronic
1023955397 7:44883177-44883199 TTTAAAAGAATAAATGATGCTGG + Exonic
1024392842 7:48835197-48835219 ATTAAAAGAGTGAGAGAGGCTGG + Intergenic
1024756750 7:52542109-52542131 ATTAAAAGGATGAATGAGTTAGG - Intergenic
1024826492 7:53397065-53397087 ATGTAAAGACTAATTGAGGCAGG - Intergenic
1024829604 7:53434646-53434668 ATCACAAGACTGAATGATCCTGG + Intergenic
1025114977 7:56249855-56249877 TTTAAATGAATGAATGAGTCAGG - Intergenic
1025162881 7:56680279-56680301 ATTAAAAGCTACAATGAGGCTGG + Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026340788 7:69432220-69432242 ATTACGAGACTGAATGAAGGGGG + Intergenic
1026712142 7:72751751-72751773 AATAAAAGAATGAATGAACCAGG - Intronic
1026809984 7:73455483-73455505 ATTAAAAGACCAAATGTGGCTGG + Intronic
1026977454 7:74507176-74507198 ATTAAAAGCTTCGATGAGGCTGG + Intronic
1027576244 7:79934674-79934696 ATAAAAAGACAGAAAGAGTCTGG + Intergenic
1027927431 7:84484311-84484333 ATTAAAAGACTGAATAAAACAGG + Intronic
1028341809 7:89731643-89731665 ATTACAAGACTGAACGAAGGGGG + Intergenic
1028971958 7:96869179-96869201 ATTAATACACAGAATGAGGTTGG + Intergenic
1029958642 7:104666819-104666841 ATTAAAAAAAAGAATGAGGCTGG - Intronic
1030533186 7:110735496-110735518 ATCAAGACAATGAATGAGGCTGG + Intronic
1030594776 7:111524924-111524946 GTTGAAAGAATGAATGAGCCAGG - Intronic
1031148707 7:118027434-118027456 ATTAAAAGTATGGAAGAGGCCGG - Intergenic
1031290984 7:119934177-119934199 ATTTAAAGACTTAAAGAGGAAGG + Intergenic
1031372628 7:120986373-120986395 GTCAGAAGAGTGAATGAGGCCGG - Intergenic
1032624635 7:133577794-133577816 ATTAACTGAGTGAATGAAGCTGG + Intronic
1032744835 7:134775413-134775435 ATTAGAATAATGAATGCGGCCGG + Intronic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1033166480 7:139042835-139042857 ATTAAAAAAGATAATGAGGCCGG + Intergenic
1034110174 7:148529330-148529352 ACTACAAGACTGAAAGGGGCTGG + Intergenic
1034692246 7:153023169-153023191 TTTAAATGACTGAATGCGCCAGG - Intergenic
1034791828 7:153977530-153977552 ACAAAAAGAAAGAATGAGGCTGG - Intronic
1035539691 8:423351-423373 ATGAAAATATTGCATGAGGCTGG + Intronic
1036083609 8:5588058-5588080 ATAAAAAGCGTGAATAAGGCAGG - Intergenic
1036524080 8:9518972-9518994 CTTAAAAAACTGAAAGGGGCCGG - Intergenic
1036666660 8:10748419-10748441 ATTAAAAGAATTAAGGAGGCCGG - Intronic
1037652948 8:20856281-20856303 ACTATATGACTTAATGAGGCAGG - Intergenic
1037863569 8:22424729-22424751 ATGAAAAAACTAAATGAGCCAGG + Intronic
1038931993 8:32203656-32203678 AATAAATGAATGAATGAGGCTGG - Intronic
1039309700 8:36303166-36303188 ATCAAATGAGAGAATGAGGCTGG - Intergenic
1040615735 8:49036518-49036540 ATAAAAATCCTGGATGAGGCCGG + Intergenic
1041631607 8:60094574-60094596 GTCAAAAGACTGAAGGAGTCAGG - Intergenic
1041991573 8:63999286-63999308 ATTAGAAAACTGAATAGGGCTGG + Intergenic
1042379609 8:68097619-68097641 AATAAGAAATTGAATGAGGCTGG - Intronic
1042395167 8:68283632-68283654 ATTAAAAGACAGAAATTGGCAGG - Intergenic
1043574770 8:81644858-81644880 ATAAAAATAGTGACTGAGGCTGG - Intergenic
1043879759 8:85529120-85529142 AATAAATAAATGAATGAGGCTGG + Intergenic
1044511981 8:93092389-93092411 ATTAAAAGAATCTGTGAGGCTGG + Intergenic
1044664197 8:94619412-94619434 ATTAAAAAAATGAATAAGTCAGG + Intergenic
1045499209 8:102732125-102732147 CTTCACAGACTGATTGAGGCTGG - Intergenic
1045704669 8:104908066-104908088 AATAAAACACTGCATTAGGCTGG - Intronic
1046802415 8:118443165-118443187 TTTTTAAGACTGTATGAGGCTGG + Intronic
1047168120 8:122463287-122463309 AATAAAAAAATTAATGAGGCTGG - Intergenic
1047220513 8:122914875-122914897 ATTAAAATATTGAATGCAGCAGG - Intronic
1047823672 8:128550096-128550118 TTTAAAAGATCAAATGAGGCCGG + Intergenic
1048253674 8:132888268-132888290 ATTCAAAGTCTGTATGAGGCTGG + Exonic
1048633079 8:136265727-136265749 ATTATAAGTCTGAAGGAGGCTGG - Intergenic
1048932339 8:139325176-139325198 ACTCAATGACTGAATGAGGCAGG + Intergenic
1049926972 9:418890-418912 AAAAAAAGACTGAAGGAGGCTGG + Intronic
1049997236 9:1045004-1045026 TTAAAAAGACGGTATGAGGCAGG + Intergenic
1050348220 9:4714920-4714942 ATGAAAAGACTGAATTCGGCCGG + Intronic
1050408002 9:5330340-5330362 ATTAAAAGAATTAGAGAGGCCGG + Intergenic
1050881368 9:10704251-10704273 AATAAAATACTGAATGGTGCTGG - Intergenic
1051247357 9:15125334-15125356 ATTTATAGACTGAATGCTGCCGG + Intergenic
1051427824 9:16951473-16951495 GGTAAAAGACTGAATTGGGCGGG - Intergenic
1051769317 9:20558987-20559009 ACTAAAAGGCTGAATGATGAGGG + Intronic
1052933572 9:34075293-34075315 AAAAAAAGAAAGAATGAGGCTGG - Intergenic
1052978893 9:34432739-34432761 GTTAAAAGGCAGAACGAGGCTGG - Intronic
1053075608 9:35131389-35131411 AATAAAAAATTGAATGAGGCCGG - Intergenic
1053227785 9:36376073-36376095 AATCAAAGACTGAATGAGAGAGG + Exonic
1053910016 9:42889070-42889092 ATTAAAAAAAAGAATGAGGTAGG + Intergenic
1054371773 9:64406017-64406039 ATTAAAAAAAAGAATGAGGTAGG + Intronic
1054753223 9:68929964-68929986 TTAAGAAGACTGAAAGAGGCTGG - Intronic
1054862902 9:69971439-69971461 AATAAAAGAATGAATTTGGCAGG - Intergenic
1055261224 9:74436419-74436441 ACTAAACAAATGAATGAGGCTGG - Intergenic
1055812627 9:80167102-80167124 ATTAAAAATCTTAATGAGGAAGG + Intergenic
1055839244 9:80482789-80482811 ATTATGAGACTGAATGAAGGGGG - Intergenic
1055978876 9:81981073-81981095 ATTATAAGATTGAATTAGGAAGG + Intergenic
1056333098 9:85538024-85538046 ACTCAAAGGCTGAATGAGTCAGG + Intergenic
1056441154 9:86622552-86622574 TCTAAAAGACTGGATGAGGCCGG + Intergenic
1057419107 9:94895075-94895097 ATCAAAAGGCAGCATGAGGCTGG + Intronic
1057518007 9:95737948-95737970 CTTAAAAAACTGAACTAGGCTGG - Intergenic
1057563280 9:96145715-96145737 ATTAAAACACACAAGGAGGCTGG - Intergenic
1057769788 9:97957633-97957655 TTTAAAATACTGTATAAGGCCGG + Intergenic
1058024718 9:100129183-100129205 ATTAAAAGAAGGAATCTGGCAGG + Intronic
1058207261 9:102124488-102124510 ATTTGAAAAGTGAATGAGGCAGG + Intergenic
1059150127 9:111942074-111942096 CTTAAAAGTTTGAAAGAGGCTGG + Intergenic
1059551044 9:115229418-115229440 ATTACAAGACTGAACGAAGGAGG + Intronic
1060119780 9:120977714-120977736 TTTAAAATACAGATTGAGGCCGG - Intronic
1061461505 9:130743367-130743389 ATTAAAAGAATAAACTAGGCTGG - Intronic
1061774912 9:132955586-132955608 TTTAAAAAGCTGAAAGAGGCTGG - Intronic
1062672381 9:137719047-137719069 ATTAAAAGAACTAATCAGGCCGG - Intronic
1185839458 X:3375203-3375225 ATTGAAAGAATGAATGAGCATGG - Intergenic
1186014995 X:5181291-5181313 TTTAAAAGAATGAATAAGGGTGG + Intergenic
1186097265 X:6115995-6116017 AATAAAGAACTGAATGAGGCTGG + Intronic
1187254691 X:17631542-17631564 ATTAAATAACTGAATGAAGGTGG + Intronic
1187424103 X:19161570-19161592 ATTAAGAATCTTAATGAGGCTGG + Intergenic
1187909342 X:24096351-24096373 ATTAAAAAAATAAAAGAGGCTGG - Intergenic
1187957284 X:24531967-24531989 ATTAAAATACTGATTTTGGCCGG + Intronic
1188347510 X:29084987-29085009 ATTAAAAGAATAAATGCGGCTGG - Intronic
1188711800 X:33410225-33410247 ATTTAAGGACTGATGGAGGCAGG + Intergenic
1189589976 X:42500460-42500482 ATTTCAAGACTGAGTGAGGGCGG - Intergenic
1191910578 X:66144826-66144848 ATTTAAAGATTGAGTAAGGCAGG - Intergenic
1192506422 X:71687040-71687062 ATGAAAATACTGAATGCTGCTGG + Intergenic
1192520275 X:71794507-71794529 ATGAAAATACTGAATGCTGCTGG - Intergenic
1192552022 X:72062097-72062119 ATTGAATGAATGAATGAGGTAGG + Intergenic
1193796252 X:85878181-85878203 ATTAAAAGACTATTAGAGGCTGG + Intronic
1194158118 X:90418297-90418319 TTTAAAGGACAGAATCAGGCAGG + Intergenic
1194555359 X:95351743-95351765 ATTCAAAGCCTGAATGAGTTAGG - Intergenic
1194564181 X:95462480-95462502 ATTAAAAGATGGAATGATGAGGG - Intergenic
1195280271 X:103326662-103326684 ATAAAAAGCCTGTATGTGGCTGG + Intergenic
1196263599 X:113615049-113615071 ATCAATAGACTGAATAGGGCAGG - Intergenic
1196636455 X:118008241-118008263 AATAAAAGACTGAAAAAGGAGGG + Intronic
1196791021 X:119464927-119464949 ATTAAAAGTATGAATGGGGCCGG - Intergenic
1198245614 X:134828385-134828407 TTCAAAATATTGAATGAGGCCGG - Intronic
1198443252 X:136685045-136685067 AGTAAAAGATTGATTGAGTCAGG - Intronic
1199354125 X:146840168-146840190 ATTAAAAGACTGAAATATGAAGG - Intergenic
1199675204 X:150182860-150182882 AGGAAACCACTGAATGAGGCAGG + Intergenic
1200504445 Y:3995261-3995283 TTTAAAGGACAGAATCAGGCAGG + Intergenic
1201484562 Y:14478689-14478711 ATAAAAAATGTGAATGAGGCCGG + Intergenic
1201948684 Y:19540017-19540039 ATTAAAAAGTTGAGTGAGGCCGG + Intergenic